Incidental Mutation 'R5487:Trpc2'
ID430414
Institutional Source Beutler Lab
Gene Symbol Trpc2
Ensembl Gene ENSMUSG00000100254
Gene Nametransient receptor potential cation channel, subfamily C, member 2
Synonymstrp2, mTrp2, TRPC2a, TRPC2b, 3010009O07Rik, Trrp2
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5487 (G1)
Quality Score217
Status Not validated
Chromosome7
Chromosomal Location102083116-102096396 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GTGTCCTA to GTGTCCTATGTCCTA at 102095213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084843] [ENSMUST00000094128] [ENSMUST00000094129] [ENSMUST00000106934] [ENSMUST00000106935] [ENSMUST00000106937] [ENSMUST00000123372] [ENSMUST00000124189] [ENSMUST00000139104]
Predicted Effect probably null
Transcript: ENSMUST00000084843
SMART Domains Protein: ENSMUSP00000081903
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 150 1.4e-54 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 1e-24 PFAM
Pfam:Ion_trans 716 1024 1.7e-24 PFAM
Pfam:PKD_channel 774 1019 2.4e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094128
SMART Domains Protein: ENSMUSP00000091678
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 3.6e-96 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094129
SMART Domains Protein: ENSMUSP00000091679
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 1.2e-27 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
low complexity region 345 362 N/A INTRINSIC
low complexity region 403 415 N/A INTRINSIC
low complexity region 416 428 N/A INTRINSIC
ANK 439 469 1.58e3 SMART
low complexity region 484 496 N/A INTRINSIC
ANK 522 551 1.74e0 SMART
Pfam:TRP_2 557 619 2.8e-28 PFAM
transmembrane domain 719 741 N/A INTRINSIC
Pfam:PKD_channel 772 1019 3.8e-12 PFAM
Pfam:Ion_trans 796 1012 3.9e-31 PFAM
low complexity region 1070 1081 N/A INTRINSIC
low complexity region 1093 1104 N/A INTRINSIC
coiled coil region 1122 1162 N/A INTRINSIC
low complexity region 1220 1236 N/A INTRINSIC
low complexity region 1247 1263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106934
SMART Domains Protein: ENSMUSP00000102547
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 117 3.7e-29 PFAM
Pfam:ART 114 157 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106935
SMART Domains Protein: ENSMUSP00000102548
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 146 2.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106937
SMART Domains Protein: ENSMUSP00000102550
Gene: ENSMUSG00000070424

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ART 29 255 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123372
SMART Domains Protein: ENSMUSP00000121068
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 152 5.2e-29 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 280 N/A INTRINSIC
low complexity region 297 311 N/A INTRINSIC
internal_repeat_1 324 345 2.69e-6 PROSPERO
low complexity region 346 379 N/A INTRINSIC
internal_repeat_1 380 401 2.69e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000124189
SMART Domains Protein: ENSMUSP00000116934
Gene: ENSMUSG00000100254

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
ANK 65 95 1.58e3 SMART
low complexity region 110 122 N/A INTRINSIC
ANK 148 177 1.74e0 SMART
Pfam:TRP_2 183 245 9.1e-29 PFAM
transmembrane domain 345 367 N/A INTRINSIC
Pfam:PKD_channel 398 645 1.4e-12 PFAM
Pfam:Ion_trans 422 638 1e-31 PFAM
low complexity region 696 707 N/A INTRINSIC
low complexity region 719 730 N/A INTRINSIC
coiled coil region 748 788 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139104
SMART Domains Protein: ENSMUSP00000122430
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 3.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155078
SMART Domains Protein: ENSMUSP00000123466
Gene: ENSMUSG00000070425

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 62 4.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211553
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit altered sexual and social behavior, including intermale mounting and a lack of aggressive behavior in the presence of invading males. Homozygotes for another allele show increased triglyceride levels in both males and femalesand increased cholesterol in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Trpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0443:Trpc2 UTSW 7 102093520 splice site probably benign
R0601:Trpc2 UTSW 7 102084365 missense possibly damaging 0.53
R1303:Trpc2 UTSW 7 102088161 missense probably damaging 1.00
R1493:Trpc2 UTSW 7 102090576 missense probably damaging 0.97
R1579:Trpc2 UTSW 7 102084240 missense probably damaging 0.99
R1829:Trpc2 UTSW 7 102084119 missense probably damaging 1.00
R2010:Trpc2 UTSW 7 102094573 missense probably benign
R3103:Trpc2 UTSW 7 102095234 missense possibly damaging 0.74
R3738:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3739:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R3938:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3945:Trpc2 UTSW 7 102088279 missense possibly damaging 0.52
R3951:Trpc2 UTSW 7 102093574 missense probably damaging 1.00
R3970:Trpc2 UTSW 7 102084324 missense probably damaging 1.00
R4035:Trpc2 UTSW 7 102084504 missense probably damaging 1.00
R4234:Trpc2 UTSW 7 102088135 missense possibly damaging 0.52
R4329:Trpc2 UTSW 7 102087520 missense probably damaging 1.00
R4531:Trpc2 UTSW 7 102095998 missense probably damaging 1.00
R4857:Trpc2 UTSW 7 102083969 missense probably benign 0.18
R5058:Trpc2 UTSW 7 102089109 missense probably damaging 1.00
R5093:Trpc2 UTSW 7 102095183 missense probably benign
R5485:Trpc2 UTSW 7 102095213 frame shift probably null
R5486:Trpc2 UTSW 7 102095213 frame shift probably null
R5782:Trpc2 UTSW 7 102083979 missense possibly damaging 0.85
R6379:Trpc2 UTSW 7 102096091 nonsense probably null
R6572:Trpc2 UTSW 7 102090006 missense probably damaging 1.00
R6674:Trpc2 UTSW 7 102096057 missense probably benign 0.36
R7513:Trpc2 UTSW 7 102090068 missense probably damaging 0.99
RF020:Trpc2 UTSW 7 102096226 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTGCTGCAGTTCTTCAGGG -3'
(R):5'- AGCCTAATGCAGAAGTGTGG -3'

Sequencing Primer
(F):5'- GCAGTTCTTCAGGGGTCTTTCC -3'
(R):5'- CTAATGCAGAAGTGTGGAGGGTG -3'
Posted On2016-10-05