Incidental Mutation 'R5487:Igdcc3'
ID430420
Institutional Source Beutler Lab
Gene Symbol Igdcc3
Ensembl Gene ENSMUSG00000032394
Gene Nameimmunoglobulin superfamily, DCC subclass, member 3
SynonymsPunc, WI-14920, 2810401C09Rik
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5487 (G1)
Quality Score157
Status Not validated
Chromosome9
Chromosomal Location65141189-65185872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65181584 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 415 (E415G)
Ref Sequence ENSEMBL: ENSMUSP00000149084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034961] [ENSMUST00000217371]
Predicted Effect probably damaging
Transcript: ENSMUST00000034961
AA Change: E415G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034961
Gene: ENSMUSG00000032394
AA Change: E415G

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
IGc2 66 136 1.28e-10 SMART
IGc2 163 228 4.77e-10 SMART
IGc2 262 326 8.06e-8 SMART
IGc2 354 419 3.17e-15 SMART
FN3 436 519 1.2e-13 SMART
FN3 534 615 2.66e-6 SMART
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217135
Predicted Effect probably damaging
Transcript: ENSMUST00000217371
AA Change: E415G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a gene trap mutation exhibit reduced performance on the rotarod, suggesting impaired cerebellar function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Igdcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Igdcc3 APN 9 65182019 missense probably damaging 1.00
IGL01310:Igdcc3 APN 9 65178442 missense probably damaging 0.98
IGL01545:Igdcc3 APN 9 65180073 missense probably damaging 1.00
IGL01576:Igdcc3 APN 9 65177870 missense probably damaging 1.00
IGL01909:Igdcc3 APN 9 65144537 missense probably damaging 1.00
IGL02039:Igdcc3 APN 9 65183880 missense probably benign 0.18
IGL02055:Igdcc3 APN 9 65181280 missense possibly damaging 0.92
IGL02565:Igdcc3 APN 9 65180188 missense probably damaging 1.00
R1776:Igdcc3 UTSW 9 65182752 nonsense probably null
R4731:Igdcc3 UTSW 9 65181997 missense probably damaging 1.00
R5413:Igdcc3 UTSW 9 65177515 missense possibly damaging 0.61
R5744:Igdcc3 UTSW 9 65141488 small deletion probably benign
R6578:Igdcc3 UTSW 9 65182019 missense probably damaging 1.00
R6867:Igdcc3 UTSW 9 65183038 missense probably damaging 1.00
R6992:Igdcc3 UTSW 9 65181571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTAAGTCTTCAGCCCACC -3'
(R):5'- AGCTCTTCTGAGGGTCACTAC -3'

Sequencing Primer
(F):5'- CACCCTTGTGCAAATGAGTC -3'
(R):5'- GCCTTCCTGATGTGCAAGACATAG -3'
Posted On2016-10-05