Mutagenetix > Incidental Mutations

Incidental Mutation 'R5487:Tph2'

430423

Institutional Source

Beutler Lab

Gene Symbol

Tph2

Ensembl Gene

ENSMUSG00000006764

Gene Name

tryptophan hydroxylase 2

Synonyms

MMRRC Submission

043048-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.309) question?

Stock #

R5487 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115078641-115185022 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 115119874 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 338 (G338D)

Ref Sequence

ENSEMBL: ENSMUSP00000006949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006949]

Predicted Effect

probably damaging
Transcript: ENSMUST00000006949
AA Change: G338D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: G338D

Domain	Start	End	E-Value	Type
low complexity region	94	102	N/A	INTRINSIC
Pfam:Biopterin_H	150	480	3.6e-177	PFAM

Coding Region Coverage

1x: 98.2%
3x: 97.1%
10x: 94.6%
20x: 89.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,953,514	V959A	probably damaging	Het
AI314180	T	C	4: 58,809,421	D1651G	probably benign	Het
Alg3	A	T	16: 20,607,780	I115N	probably damaging	Het
Ash1l	A	G	3: 88,981,426	D204G	probably benign	Het
Camta1	C	A	4: 151,144,754	E540D	possibly damaging	Het
Cblc	T	C	7: 19,784,808	T413A	probably benign	Het
Ccdc122	T	A	14: 77,091,679	H57Q	probably benign	Het
Ccdc85a	A	T	11: 28,576,768	L280*	probably null	Het
Cd46	T	G	1: 195,068,170		probably null	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Dnaaf3	T	C	7: 4,523,865		probably null	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Eif2ak1	A	G	5: 143,897,163		probably null	Het
Erich4	A	G	7: 25,615,239	M83T	probably benign	Het
Fbxo24	C	T	5: 137,618,832	G331E	possibly damaging	Het
Fzd4	A	G	7: 89,407,407	I221V	probably benign	Het
G6pc2	T	C	2: 69,226,577	V189A	probably damaging	Het
Gm10663	A	C	8: 65,075,034	E1A	probably null	Het
Gm4871	C	A	5: 145,030,389	E178D	probably damaging	Het
Igdcc3	A	G	9: 65,181,584	E415G	probably damaging	Het
Kmt2a	A	T	9: 44,821,975		probably benign	Het
Krba1	T	C	6: 48,404,039	V103A	probably damaging	Het
Lcat	T	C	8: 105,939,664	K409E	probably benign	Het
Lrriq4	C	A	3: 30,659,995	N497K	probably benign	Het
Mical2	A	G	7: 112,320,635	T451A	probably damaging	Het
Noxo1	C	T	17: 24,698,317		probably benign	Het
Oas1a	A	G	5: 120,907,427	I17T	probably damaging	Het
Otog	A	T	7: 46,288,768	Y1967F	probably benign	Het
Pcdha9	A	T	18: 36,999,650	N591Y	probably damaging	Het
Plxna4	A	G	6: 32,517,283	Y133H	probably damaging	Het
Pou5f2	T	C	13: 78,024,999	L20P	probably benign	Het
Prkcb	T	A	7: 122,600,725	C586*	probably null	Het
Sema3b	A	T	9: 107,600,962	M408K	probably damaging	Het
Serpinf2	G	A	11: 75,433,205	T332I	probably damaging	Het
Tmbim1	A	G	1: 74,293,005	V121A	probably benign	Het
Trpc2	GTGTCCTA	GTGTCCTATGTCCTA	7: 102,095,213		probably null	Het
Ttn	C	T	2: 76,812,552	V13247M	probably damaging	Het
Uty	C	T	Y: 1,174,825	G192R	probably damaging	Het
Vmn2r65	G	T	7: 84,946,321	P385Q	possibly damaging	Het
Wdfy3	G	A	5: 101,836,274	R3489W	probably damaging	Het
Zfp750	A	G	11: 121,513,732	S106P	probably benign	Het

Other mutations in Tph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01469:Tph2	APN	10	115079759	nonsense	probably null
IGL01989:Tph2	APN	10	115146016	missense	probably benign	0.22
IGL02363:Tph2	APN	10	115079981	missense	probably benign	0.01
IGL02667:Tph2	APN	10	115080045	missense	probably benign	0.43
R0390:Tph2	UTSW	10	115174109	missense	probably damaging	1.00
R0400:Tph2	UTSW	10	115080120	splice site	probably benign
R0570:Tph2	UTSW	10	115174134	splice site	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1466:Tph2	UTSW	10	115079695	missense	probably benign
R1654:Tph2	UTSW	10	115184807	missense	probably benign
R3705:Tph2	UTSW	10	115119893	nonsense	probably null
R3710:Tph2	UTSW	10	115174058	missense	probably benign	0.42
R3777:Tph2	UTSW	10	115080005	missense	probably benign
R4794:Tph2	UTSW	10	115182770	missense	possibly damaging	0.84
R5015:Tph2	UTSW	10	115079716	missense	probably benign	0.01
R5068:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5069:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5070:Tph2	UTSW	10	115151174	missense	probably benign	0.00
R5422:Tph2	UTSW	10	115079764	missense	possibly damaging	0.94
R5604:Tph2	UTSW	10	115090709	missense	probably damaging	1.00
R5692:Tph2	UTSW	10	115184827	missense	probably damaging	0.97
R6368:Tph2	UTSW	10	115179326	missense	probably damaging	1.00
R6802:Tph2	UTSW	10	115184873	missense	probably damaging	1.00
R6823:Tph2	UTSW	10	115174106	missense	probably benign	0.02
R7371:Tph2	UTSW	10	115151111	missense	probably damaging	1.00
R7724:Tph2	UTSW	10	115079822	missense	probably benign
R7863:Tph2	UTSW	10	115080001	missense	probably damaging	1.00
R7946:Tph2	UTSW	10	115080001	missense	probably damaging	1.00
R8046:Tph2	UTSW	10	115179594	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGGTAGCTAATAAACCTGGAGTTC -3'
(R):5'- GTGCATTTACATTTCAGGCATGAC -3'

Sequencing Primer
(F):5'- TTTGCCAAACAAGAACAAAGTTAGG -3'
(R):5'- CATTTCAGGCATGACTAATGGTAATC -3'

Posted On

2016-10-05