Incidental Mutation 'R5487:Tph2'
ID 430423
Institutional Source Beutler Lab
Gene Symbol Tph2
Ensembl Gene ENSMUSG00000006764
Gene Name tryptophan hydroxylase 2
Synonyms
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock # R5487 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 115078641-115185022 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 115119874 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 338 (G338D)
Ref Sequence ENSEMBL: ENSMUSP00000006949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006949]
AlphaFold Q8CGV2
Predicted Effect probably damaging
Transcript: ENSMUST00000006949
AA Change: G338D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006949
Gene: ENSMUSG00000006764
AA Change: G338D

DomainStartEndE-ValueType
low complexity region 94 102 N/A INTRINSIC
Pfam:Biopterin_H 150 480 3.6e-177 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pterin-dependent aromatic acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene may be associated with psychiatric diseases such as bipolar affective disorder and major depression. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mutations in this locus result in abnormal serotonin levels in the brain. Whether an increase or decrease in serotonin levels is seen depends on the specific nucleotide substitution/point mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Tph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Tph2 APN 10 115079759 nonsense probably null
IGL01989:Tph2 APN 10 115146016 missense probably benign 0.22
IGL02363:Tph2 APN 10 115079981 missense probably benign 0.01
IGL02667:Tph2 APN 10 115080045 missense probably benign 0.43
R0390:Tph2 UTSW 10 115174109 missense probably damaging 1.00
R0400:Tph2 UTSW 10 115080120 splice site probably benign
R0570:Tph2 UTSW 10 115174134 splice site probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1466:Tph2 UTSW 10 115079695 missense probably benign
R1654:Tph2 UTSW 10 115184807 missense probably benign
R3705:Tph2 UTSW 10 115119893 nonsense probably null
R3710:Tph2 UTSW 10 115174058 missense probably benign 0.42
R3777:Tph2 UTSW 10 115080005 missense probably benign
R4794:Tph2 UTSW 10 115182770 missense possibly damaging 0.84
R5015:Tph2 UTSW 10 115079716 missense probably benign 0.01
R5068:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5069:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5070:Tph2 UTSW 10 115151174 missense probably benign 0.00
R5422:Tph2 UTSW 10 115079764 missense possibly damaging 0.94
R5604:Tph2 UTSW 10 115090709 missense probably damaging 1.00
R5692:Tph2 UTSW 10 115184827 missense probably damaging 0.97
R6368:Tph2 UTSW 10 115179326 missense probably damaging 1.00
R6802:Tph2 UTSW 10 115184873 missense probably damaging 1.00
R6823:Tph2 UTSW 10 115174106 missense probably benign 0.02
R7371:Tph2 UTSW 10 115151111 missense probably damaging 1.00
R7724:Tph2 UTSW 10 115079822 missense probably benign
R7863:Tph2 UTSW 10 115080001 missense probably damaging 1.00
R8046:Tph2 UTSW 10 115179594 missense possibly damaging 0.62
R8738:Tph2 UTSW 10 115179709 splice site probably benign
R9464:Tph2 UTSW 10 115080087 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTAGCTAATAAACCTGGAGTTC -3'
(R):5'- GTGCATTTACATTTCAGGCATGAC -3'

Sequencing Primer
(F):5'- TTTGCCAAACAAGAACAAAGTTAGG -3'
(R):5'- CATTTCAGGCATGACTAATGGTAATC -3'
Posted On 2016-10-05