Incidental Mutation 'R5487:Ccdc85a'
ID430424
Institutional Source Beutler Lab
Gene Symbol Ccdc85a
Ensembl Gene ENSMUSG00000032878
Gene Namecoiled-coil domain containing 85A
Synonyms
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location28385685-28584324 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28576768 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 280 (L280*)
Ref Sequence ENSEMBL: ENSMUSP00000124972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042534] [ENSMUST00000093253] [ENSMUST00000109502] [ENSMUST00000146385]
Predicted Effect probably null
Transcript: ENSMUST00000042534
AA Change: L280*
SMART Domains Protein: ENSMUSP00000044649
Gene: ENSMUSG00000032878
AA Change: L280*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:DUF2216 26 219 6e-103 PFAM
internal_repeat_1 297 368 2.42e-23 PROSPERO
low complexity region 371 380 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093253
AA Change: L280*
SMART Domains Protein: ENSMUSP00000090941
Gene: ENSMUSG00000032878
AA Change: L280*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:DUF2216 26 219 7.3e-103 PFAM
internal_repeat_1 297 368 4.37e-22 PROSPERO
low complexity region 371 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109501
Predicted Effect probably null
Transcript: ENSMUST00000109502
AA Change: L252*
SMART Domains Protein: ENSMUSP00000105128
Gene: ENSMUSG00000032878
AA Change: L252*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:DUF2216 26 225 2.1e-85 PFAM
internal_repeat_1 269 340 3.64e-23 PROSPERO
low complexity region 343 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140601
Predicted Effect probably null
Transcript: ENSMUST00000146385
AA Change: L280*
SMART Domains Protein: ENSMUSP00000124972
Gene: ENSMUSG00000032878
AA Change: L280*

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:DUF2216 28 219 1.4e-100 PFAM
internal_repeat_1 297 368 7.15e-22 PROSPERO
low complexity region 371 380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Ccdc85a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Ccdc85a APN 11 28576506 missense probably damaging 1.00
IGL02260:Ccdc85a APN 11 28576672 missense possibly damaging 0.86
IGL03408:Ccdc85a APN 11 28576528 missense probably damaging 0.99
unter UTSW 11 28577192 missense probably damaging 1.00
R0363:Ccdc85a UTSW 11 28583400 missense probably damaging 1.00
R0744:Ccdc85a UTSW 11 28583296 missense probably damaging 1.00
R0833:Ccdc85a UTSW 11 28583296 missense probably damaging 1.00
R0836:Ccdc85a UTSW 11 28583296 missense probably damaging 1.00
R1241:Ccdc85a UTSW 11 28396150 missense probably benign 0.01
R1395:Ccdc85a UTSW 11 28583412 missense possibly damaging 0.84
R1679:Ccdc85a UTSW 11 28583316 missense probably damaging 1.00
R2132:Ccdc85a UTSW 11 28434151 missense probably benign 0.26
R2851:Ccdc85a UTSW 11 28392942 intron probably benign
R2853:Ccdc85a UTSW 11 28392942 intron probably benign
R3021:Ccdc85a UTSW 11 28576894 missense possibly damaging 0.95
R3087:Ccdc85a UTSW 11 28392857 nonsense probably null
R3122:Ccdc85a UTSW 11 28583499 missense unknown
R3863:Ccdc85a UTSW 11 28577335 unclassified probably null
R3885:Ccdc85a UTSW 11 28576677 missense probably benign 0.21
R3963:Ccdc85a UTSW 11 28576396 missense probably benign 0.02
R4436:Ccdc85a UTSW 11 28576457 missense probably benign 0.08
R5687:Ccdc85a UTSW 11 28392854 intron probably benign
R6246:Ccdc85a UTSW 11 28576897 missense probably damaging 1.00
R6957:Ccdc85a UTSW 11 28392944 intron probably benign
R7142:Ccdc85a UTSW 11 28577192 missense probably damaging 1.00
R7307:Ccdc85a UTSW 11 28399384 missense probably benign 0.00
R7848:Ccdc85a UTSW 11 28396123 missense possibly damaging 0.85
R7931:Ccdc85a UTSW 11 28396123 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCACCAAGGGCATGTTTCTG -3'
(R):5'- ACCTCTAGCACTGGCAGTAC -3'

Sequencing Primer
(F):5'- TTCTGAAGATGCTCAGGGCTCC -3'
(R):5'- CTCTAGCACTGGCAGTACTGATAG -3'
Posted On2016-10-05