Incidental Mutation 'R5487:Serpinf2'
ID430425
Institutional Source Beutler Lab
Gene Symbol Serpinf2
Ensembl Gene ENSMUSG00000038224
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 2
Synonymsalpha 2 antiplasmin, Pli
MMRRC Submission 043048-MU
Accession Numbers

Genbank: NM_008878; MGI: 107173

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75431732-75439591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75433205 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 332 (T332I)
Ref Sequence ENSEMBL: ENSMUSP00000104076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043696] [ENSMUST00000108437] [ENSMUST00000128330] [ENSMUST00000142094]
Predicted Effect probably damaging
Transcript: ENSMUST00000043696
AA Change: T332I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048704
Gene: ENSMUSG00000038224
AA Change: T332I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108437
AA Change: T332I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104076
Gene: ENSMUSG00000038224
AA Change: T332I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 436 1.5e-137 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128330
SMART Domains Protein: ENSMUSP00000114450
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 91 280 1.07e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142094
SMART Domains Protein: ENSMUSP00000120812
Gene: ENSMUSG00000038224

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of serine protease inhibitors. The protein is a major inhibitor of plasmin, which degrades fibrin and various other proteins. Consequently, the proper function of this gene has a major role in regulating the blood clotting pathway. Mutations in this gene result in alpha-2-plasmin inhibitor deficiency, which is characterized by severe hemorrhagic diathesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have an essentially normal phenotype. Spontaneous lysis of blood clots occurs more readily but bleeding times are unaffected. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Serpinf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Serpinf2 APN 11 75436507 missense possibly damaging 0.58
IGL01367:Serpinf2 APN 11 75438045 missense probably benign
IGL01382:Serpinf2 APN 11 75438037 unclassified probably benign
R0122:Serpinf2 UTSW 11 75436546 missense probably damaging 1.00
R0135:Serpinf2 UTSW 11 75436393 missense probably damaging 1.00
R1864:Serpinf2 UTSW 11 75437483 missense possibly damaging 0.74
R2202:Serpinf2 UTSW 11 75436762 missense probably benign 0.07
R3082:Serpinf2 UTSW 11 75437528 missense probably benign 0.19
R5117:Serpinf2 UTSW 11 75432500 missense probably benign 0.28
R5681:Serpinf2 UTSW 11 75435939 missense probably damaging 0.99
R5764:Serpinf2 UTSW 11 75437404 missense possibly damaging 0.94
R5868:Serpinf2 UTSW 11 75433239 missense probably benign 0.00
R6349:Serpinf2 UTSW 11 75432431 missense probably damaging 1.00
R6364:Serpinf2 UTSW 11 75436489 missense probably damaging 1.00
R6488:Serpinf2 UTSW 11 75437503 missense probably benign
R6701:Serpinf2 UTSW 11 75432443 missense probably damaging 0.97
R7034:Serpinf2 UTSW 11 75438418 unclassified probably benign
R7036:Serpinf2 UTSW 11 75438418 unclassified probably benign
YA93:Serpinf2 UTSW 11 75432684 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGCTCCCATCCAGGAAGC -3'
(R):5'- CTGGCTCTTGTCTCAAAAGTACAG -3'

Sequencing Primer
(F):5'- ATCCAGGAAGCAGGGCCAC -3'
(R):5'- GAAGTAATTTTGGCCCAGACTCCAG -3'
Posted On2016-10-05