Mutagenetix > Incidental Mutations

Incidental Mutation 'R5487:Zfp750'

430427

Institutional Source

Beutler Lab

Gene Symbol

Zfp750

Ensembl Gene

ENSMUSG00000039238

Gene Name

zinc finger protein 750

Synonyms

A030007D23Rik

MMRRC Submission

043048-MU

Accession Numbers

NCBI RefSeq: NM_178763.4; MGI:2442210

Is this an essential gene?

Possibly essential (E-score: 0.557) question?

Stock #

R5487 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121510978-121519333 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121513732 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 106 (S106P)

Ref Sequence

ENSEMBL: ENSMUSP00000089951 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092298] [ENSMUST00000103013]

Predicted Effect

probably benign
Transcript: ENSMUST00000092298
AA Change: S106P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000089951
Gene: ENSMUSG00000039238
AA Change: S106P

Domain	Start	End	E-Value	Type
ZnF_C2H2	25	45	2.12e1	SMART
low complexity region	352	362	N/A	INTRINSIC
low complexity region	689	702	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103013

SMART Domains

Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
low complexity region	45	62	N/A	INTRINSIC
SCOP:d1b3ua_	357	742	4e-20	SMART
Pfam:TFCD_C	900	1090	1.4e-74	PFAM
low complexity region	1113	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125167

SMART Domains

Protein: ENSMUSP00000124735
Gene: ENSMUSG00000039230

Domain	Start	End	E-Value	Type
low complexity region	36	58	N/A	INTRINSIC

Coding Region Coverage

1x: 98.2%
3x: 97.1%
10x: 94.6%
20x: 89.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a nuclear localization site and a C2H2 zinc finger domain. Mutations in this gene have been associated with seborrhea-like dermatitis with psoriasiform elements. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8b	A	G	11: 109,953,514	V959A	probably damaging	Het
AI314180	T	C	4: 58,809,421	D1651G	probably benign	Het
Alg3	A	T	16: 20,607,780	I115N	probably damaging	Het
Ash1l	A	G	3: 88,981,426	D204G	probably benign	Het
Camta1	C	A	4: 151,144,754	E540D	possibly damaging	Het
Cblc	T	C	7: 19,784,808	T413A	probably benign	Het
Ccdc122	T	A	14: 77,091,679	H57Q	probably benign	Het
Ccdc85a	A	T	11: 28,576,768	L280*	probably null	Het
Cd46	T	G	1: 195,068,170		probably null	Het
Cmklr1	C	G	5: 113,614,929	D4H	possibly damaging	Het
Dnaaf3	T	C	7: 4,523,865		probably null	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Eif2ak1	A	G	5: 143,897,163		probably null	Het
Erich4	A	G	7: 25,615,239	M83T	probably benign	Het
Fbxo24	C	T	5: 137,618,832	G331E	possibly damaging	Het
Fzd4	A	G	7: 89,407,407	I221V	probably benign	Het
G6pc2	T	C	2: 69,226,577	V189A	probably damaging	Het
Gm10663	A	C	8: 65,075,034	E1A	probably null	Het
Gm4871	C	A	5: 145,030,389	E178D	probably damaging	Het
Igdcc3	A	G	9: 65,181,584	E415G	probably damaging	Het
Kmt2a	A	T	9: 44,821,975		probably benign	Het
Krba1	T	C	6: 48,404,039	V103A	probably damaging	Het
Lcat	T	C	8: 105,939,664	K409E	probably benign	Het
Lrriq4	C	A	3: 30,659,995	N497K	probably benign	Het
Mical2	A	G	7: 112,320,635	T451A	probably damaging	Het
Noxo1	C	T	17: 24,698,317		probably benign	Het
Oas1a	A	G	5: 120,907,427	I17T	probably damaging	Het
Otog	A	T	7: 46,288,768	Y1967F	probably benign	Het
Pcdha9	A	T	18: 36,999,650	N591Y	probably damaging	Het
Plxna4	A	G	6: 32,517,283	Y133H	probably damaging	Het
Pou5f2	T	C	13: 78,024,999	L20P	probably benign	Het
Prkcb	T	A	7: 122,600,725	C586*	probably null	Het
Sema3b	A	T	9: 107,600,962	M408K	probably damaging	Het
Serpinf2	G	A	11: 75,433,205	T332I	probably damaging	Het
Tmbim1	A	G	1: 74,293,005	V121A	probably benign	Het
Tph2	C	T	10: 115,119,874	G338D	probably damaging	Het
Trpc2	GTGTCCTA	GTGTCCTATGTCCTA	7: 102,095,213		probably null	Het
Ttn	C	T	2: 76,812,552	V13247M	probably damaging	Het
Uty	C	T	Y: 1,174,825	G192R	probably damaging	Het
Vmn2r65	G	T	7: 84,946,321	P385Q	possibly damaging	Het
Wdfy3	G	A	5: 101,836,274	R3489W	probably damaging	Het

Other mutations in Zfp750

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Zfp750	APN	11	121513096	missense	probably benign	0.07
IGL01450:Zfp750	APN	11	121513029	missense	probably benign
IGL01467:Zfp750	APN	11	121512941	nonsense	probably null
IGL01538:Zfp750	APN	11	121512165	missense	probably benign	0.02
IGL01732:Zfp750	APN	11	121512993	missense	probably benign	0.01
IGL01793:Zfp750	APN	11	121513984	missense	probably damaging	1.00
IGL02004:Zfp750	APN	11	121512149	missense	probably benign	0.00
IGL02334:Zfp750	APN	11	121512011	missense	probably benign	0.03
IGL02441:Zfp750	APN	11	121513629	missense	probably benign	0.00
IGL03173:Zfp750	APN	11	121513825	nonsense	probably null
IGL03229:Zfp750	APN	11	121512952	missense	possibly damaging	0.87
IGL03244:Zfp750	APN	11	121513687	nonsense	probably null
IGL03351:Zfp750	APN	11	121513347	missense	probably damaging	1.00
IGL03390:Zfp750	APN	11	121511944	nonsense	probably null
P0016:Zfp750	UTSW	11	121513978	nonsense	probably null
R0800:Zfp750	UTSW	11	121512012	missense	probably benign
R0900:Zfp750	UTSW	11	121512981	missense	probably benign	0.31
R1444:Zfp750	UTSW	11	121512047	missense	probably damaging	1.00
R1470:Zfp750	UTSW	11	121511993	missense	probably benign
R1470:Zfp750	UTSW	11	121511993	missense	probably benign
R2008:Zfp750	UTSW	11	121513125	missense	possibly damaging	0.92
R2009:Zfp750	UTSW	11	121513125	missense	possibly damaging	0.92
R2134:Zfp750	UTSW	11	121513932	missense	probably damaging	1.00
R2415:Zfp750	UTSW	11	121512479	missense	probably benign	0.01
R2912:Zfp750	UTSW	11	121512327	missense	probably benign	0.00
R3611:Zfp750	UTSW	11	121512155	missense	probably benign	0.03
R4648:Zfp750	UTSW	11	121511880	missense	probably benign	0.00
R5068:Zfp750	UTSW	11	121512195	missense	probably benign	0.02
X0057:Zfp750	UTSW	11	121513278	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGTCTGTGTTCCCCAACTGG -3'
(R):5'- GTCCTTTTACATGTAACGAGAAGTC -3'

Sequencing Primer
(F):5'- CTGGAACAAATGCTGAATGTCTAACC -3'
(R):5'- TCACATGAAGTACGGTCTCTG -3'

Posted On

2016-10-05