Incidental Mutation 'R5487:Zfp750'
ID430427
Institutional Source Beutler Lab
Gene Symbol Zfp750
Ensembl Gene ENSMUSG00000039238
Gene Namezinc finger protein 750
SynonymsA030007D23Rik
MMRRC Submission 043048-MU
Accession Numbers

NCBI RefSeq: NM_178763.4; MGI:2442210

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location121510978-121519333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121513732 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 106 (S106P)
Ref Sequence ENSEMBL: ENSMUSP00000089951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092298] [ENSMUST00000103013]
Predicted Effect probably benign
Transcript: ENSMUST00000092298
AA Change: S106P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089951
Gene: ENSMUSG00000039238
AA Change: S106P

DomainStartEndE-ValueType
ZnF_C2H2 25 45 2.12e1 SMART
low complexity region 352 362 N/A INTRINSIC
low complexity region 689 702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103013
SMART Domains Protein: ENSMUSP00000099302
Gene: ENSMUSG00000039230

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 45 62 N/A INTRINSIC
SCOP:d1b3ua_ 357 742 4e-20 SMART
Pfam:TFCD_C 900 1090 1.4e-74 PFAM
low complexity region 1113 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125167
SMART Domains Protein: ENSMUSP00000124735
Gene: ENSMUSG00000039230

DomainStartEndE-ValueType
low complexity region 36 58 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a nuclear localization site and a C2H2 zinc finger domain. Mutations in this gene have been associated with seborrhea-like dermatitis with psoriasiform elements. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Other mutations in Zfp750
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Zfp750 APN 11 121513096 missense probably benign 0.07
IGL01450:Zfp750 APN 11 121513029 missense probably benign
IGL01467:Zfp750 APN 11 121512941 nonsense probably null
IGL01538:Zfp750 APN 11 121512165 missense probably benign 0.02
IGL01732:Zfp750 APN 11 121512993 missense probably benign 0.01
IGL01793:Zfp750 APN 11 121513984 missense probably damaging 1.00
IGL02004:Zfp750 APN 11 121512149 missense probably benign 0.00
IGL02334:Zfp750 APN 11 121512011 missense probably benign 0.03
IGL02441:Zfp750 APN 11 121513629 missense probably benign 0.00
IGL03173:Zfp750 APN 11 121513825 nonsense probably null
IGL03229:Zfp750 APN 11 121512952 missense possibly damaging 0.87
IGL03244:Zfp750 APN 11 121513687 nonsense probably null
IGL03351:Zfp750 APN 11 121513347 missense probably damaging 1.00
IGL03390:Zfp750 APN 11 121511944 nonsense probably null
P0016:Zfp750 UTSW 11 121513978 nonsense probably null
R0800:Zfp750 UTSW 11 121512012 missense probably benign
R0900:Zfp750 UTSW 11 121512981 missense probably benign 0.31
R1444:Zfp750 UTSW 11 121512047 missense probably damaging 1.00
R1470:Zfp750 UTSW 11 121511993 missense probably benign
R1470:Zfp750 UTSW 11 121511993 missense probably benign
R2008:Zfp750 UTSW 11 121513125 missense possibly damaging 0.92
R2009:Zfp750 UTSW 11 121513125 missense possibly damaging 0.92
R2134:Zfp750 UTSW 11 121513932 missense probably damaging 1.00
R2415:Zfp750 UTSW 11 121512479 missense probably benign 0.01
R2912:Zfp750 UTSW 11 121512327 missense probably benign 0.00
R3611:Zfp750 UTSW 11 121512155 missense probably benign 0.03
R4648:Zfp750 UTSW 11 121511880 missense probably benign 0.00
R5068:Zfp750 UTSW 11 121512195 missense probably benign 0.02
X0057:Zfp750 UTSW 11 121513278 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTGTGTTCCCCAACTGG -3'
(R):5'- GTCCTTTTACATGTAACGAGAAGTC -3'

Sequencing Primer
(F):5'- CTGGAACAAATGCTGAATGTCTAACC -3'
(R):5'- TCACATGAAGTACGGTCTCTG -3'
Posted On2016-10-05