Incidental Mutation 'R5487:Pou5f2'
ID430428
Institutional Source Beutler Lab
Gene Symbol Pou5f2
Ensembl Gene ENSMUSG00000093668
Gene NamePOU domain class 5, transcription factor 2
SynonymsSprm1, 1700013G10Rik
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5487 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location78024902-78026295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78024999 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 20 (L20P)
Ref Sequence ENSEMBL: ENSMUSP00000135597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091459] [ENSMUST00000099358] [ENSMUST00000163257] [ENSMUST00000175955] [ENSMUST00000224217]
Predicted Effect probably benign
Transcript: ENSMUST00000091459
SMART Domains Protein: ENSMUSP00000089038
Gene: ENSMUSG00000064138

DomainStartEndE-ValueType
Pfam:Arb2 30 178 7.8e-38 PFAM
SCOP:d1imja_ 224 295 2e-3 SMART
low complexity region 341 354 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099358
SMART Domains Protein: ENSMUSP00000096960
Gene: ENSMUSG00000064138

DomainStartEndE-ValueType
SCOP:d1imja_ 160 231 2e-3 SMART
low complexity region 277 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163257
SMART Domains Protein: ENSMUSP00000133140
Gene: ENSMUSG00000064138

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Arb2 78 228 3.5e-44 PFAM
SCOP:d1imja_ 270 341 2e-3 SMART
low complexity region 387 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175955
AA Change: L20P

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000135597
Gene: ENSMUSG00000093668
AA Change: L20P

DomainStartEndE-ValueType
POU 107 181 8.68e-33 SMART
HOX 199 261 2.57e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224217
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null male mice exhibit reduced male fertility in spite of normal morphology and sperm count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Alg3 A T 16: 20,607,780 I115N probably damaging Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Pou5f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Pou5f2 APN 13 78025938 intron probably benign
IGL01726:Pou5f2 APN 13 78025181 missense possibly damaging 0.55
IGL02484:Pou5f2 APN 13 78025905 missense probably damaging 1.00
IGL02549:Pou5f2 APN 13 78025590 missense probably damaging 0.99
IGL02850:Pou5f2 APN 13 78025059 missense probably benign 0.00
IGL02852:Pou5f2 APN 13 78025059 missense probably benign 0.00
IGL02951:Pou5f2 APN 13 78025118 missense probably benign
R0631:Pou5f2 UTSW 13 78025754 missense probably benign 0.00
R1502:Pou5f2 UTSW 13 78025251 missense probably benign 0.14
R2014:Pou5f2 UTSW 13 78025853 missense probably benign 0.00
R2055:Pou5f2 UTSW 13 78025821 missense probably benign 0.06
R4082:Pou5f2 UTSW 13 78025905 missense probably damaging 1.00
R5193:Pou5f2 UTSW 13 78024964 missense probably benign 0.15
R6880:Pou5f2 UTSW 13 78025494 missense possibly damaging 0.52
R7108:Pou5f2 UTSW 13 78025265 missense possibly damaging 0.95
R7117:Pou5f2 UTSW 13 78025273 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TAAGTTACCTCAGTCTCCAAGCC -3'
(R):5'- TGCCTCACAAGCTCTGTAGG -3'

Sequencing Primer
(F):5'- CCAGTGTCTTGCTTGCAGTGC -3'
(R):5'- CACAAGCTCTGTAGGGTGCTATC -3'
Posted On2016-10-05