Incidental Mutation 'R5487:Alg3'
ID430431
Institutional Source Beutler Lab
Gene Symbol Alg3
Ensembl Gene ENSMUSG00000033809
Gene Nameasparagine-linked glycosylation 3 (alpha-1,3-mannosyltransferase)
SynonymsD16Ertd36e
MMRRC Submission 043048-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R5487 (G1)
Quality Score200
Status Not validated
Chromosome16
Chromosomal Location20605374-20611735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20607780 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 115 (I115N)
Ref Sequence ENSEMBL: ENSMUSP00000156269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045918] [ENSMUST00000079600] [ENSMUST00000096197] [ENSMUST00000115522] [ENSMUST00000119224] [ENSMUST00000120394] [ENSMUST00000123774] [ENSMUST00000147867] [ENSMUST00000159780] [ENSMUST00000231362] [ENSMUST00000231386] [ENSMUST00000231387] [ENSMUST00000231471] [ENSMUST00000231531] [ENSMUST00000231749] [ENSMUST00000231904] [ENSMUST00000232319] [ENSMUST00000232451] [ENSMUST00000232458]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045918
AA Change: I237N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045272
Gene: ENSMUSG00000033809
AA Change: I237N

DomainStartEndE-ValueType
Pfam:ALG3 47 406 2.5e-145 PFAM
low complexity region 407 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046188
Predicted Effect probably benign
Transcript: ENSMUST00000079600
SMART Domains Protein: ENSMUSP00000078550
Gene: ENSMUSG00000115293

DomainStartEndE-ValueType
Pfam:Methyltransf_11 63 158 8.5e-8 PFAM
transmembrane domain 179 201 N/A INTRINSIC
Pfam:Peptidase_M13_N 233 618 1.2e-124 PFAM
Pfam:Peptidase_M13 677 880 1.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096197
SMART Domains Protein: ENSMUSP00000093911
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 7.3e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115522
SMART Domains Protein: ENSMUSP00000111184
Gene: ENSMUSG00000115219

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 176 5.9e-11 PFAM
Pfam:Methyltransf_31 58 208 1.5e-10 PFAM
Pfam:Methyltransf_25 62 169 1.4e-7 PFAM
Pfam:Methyltransf_12 63 171 4.5e-9 PFAM
Pfam:Methyltransf_11 63 173 2.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117019
Predicted Effect probably benign
Transcript: ENSMUST00000119224
SMART Domains Protein: ENSMUSP00000113772
Gene: ENSMUSG00000115219

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 166 1.9e-8 PFAM
Pfam:Methyltransf_25 62 142 1.7e-7 PFAM
Pfam:Methyltransf_11 63 164 5.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120394
SMART Domains Protein: ENSMUSP00000113475
Gene: ENSMUSG00000115293

DomainStartEndE-ValueType
Pfam:Methyltransf_18 58 163 1.2e-8 PFAM
Pfam:Methyltransf_11 63 163 1.7e-9 PFAM
transmembrane domain 208 230 N/A INTRINSIC
Pfam:Peptidase_M13_N 262 647 5e-109 PFAM
Pfam:Peptidase_M13 706 909 9.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123774
SMART Domains Protein: ENSMUSP00000123378
Gene: ENSMUSG00000033809

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000127454
AA Change: H147Q
SMART Domains Protein: ENSMUSP00000120559
Gene: ENSMUSG00000033809
AA Change: H147Q

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ALG3 51 118 2.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147849
SMART Domains Protein: ENSMUSP00000121231
Gene: ENSMUSG00000022842

DomainStartEndE-ValueType
Pfam:Methyltransf_18 2 105 1.1e-8 PFAM
Pfam:Methyltransf_11 7 103 1.7e-9 PFAM
transmembrane domain 123 145 N/A INTRINSIC
Pfam:Peptidase_M13_N 177 562 4e-109 PFAM
Pfam:Peptidase_M13 621 824 8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147867
Predicted Effect probably benign
Transcript: ENSMUST00000159780
SMART Domains Protein: ENSMUSP00000123727
Gene: ENSMUSG00000046613

DomainStartEndE-ValueType
Pfam:VIT_2 2 79 5.5e-31 PFAM
VWA 352 521 3.16e-1 SMART
low complexity region 684 706 N/A INTRINSIC
low complexity region 725 733 N/A INTRINSIC
low complexity region 744 764 N/A INTRINSIC
low complexity region 780 797 N/A INTRINSIC
low complexity region 823 833 N/A INTRINSIC
low complexity region 1032 1046 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231362
Predicted Effect probably damaging
Transcript: ENSMUST00000231386
AA Change: I237N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231387
AA Change: H109Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231471
AA Change: H183Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231531
AA Change: I115N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231608
Predicted Effect probably benign
Transcript: ENSMUST00000231749
Predicted Effect probably benign
Transcript: ENSMUST00000231904
Predicted Effect probably damaging
Transcript: ENSMUST00000232319
AA Change: I115N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000232451
AA Change: H61Q
Predicted Effect possibly damaging
Transcript: ENSMUST00000232458
AA Change: I163N

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.6%
  • 20x: 89.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG3 family. The encoded protein catalyses the addition of the first dol-P-Man derived mannose in an alpha 1,3 linkage to Man5GlcNAc2-PP-Dol. Defects in this gene have been associated with congenital disorder of glycosylation type Id (CDG-Id) characterized by abnormal N-glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,953,514 V959A probably damaging Het
AI314180 T C 4: 58,809,421 D1651G probably benign Het
Ash1l A G 3: 88,981,426 D204G probably benign Het
Camta1 C A 4: 151,144,754 E540D possibly damaging Het
Cblc T C 7: 19,784,808 T413A probably benign Het
Ccdc122 T A 14: 77,091,679 H57Q probably benign Het
Ccdc85a A T 11: 28,576,768 L280* probably null Het
Cd46 T G 1: 195,068,170 probably null Het
Cmklr1 C G 5: 113,614,929 D4H possibly damaging Het
Dnaaf3 T C 7: 4,523,865 probably null Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Eif2ak1 A G 5: 143,897,163 probably null Het
Erich4 A G 7: 25,615,239 M83T probably benign Het
Fbxo24 C T 5: 137,618,832 G331E possibly damaging Het
Fzd4 A G 7: 89,407,407 I221V probably benign Het
G6pc2 T C 2: 69,226,577 V189A probably damaging Het
Gm10663 A C 8: 65,075,034 E1A probably null Het
Gm4871 C A 5: 145,030,389 E178D probably damaging Het
Igdcc3 A G 9: 65,181,584 E415G probably damaging Het
Kmt2a A T 9: 44,821,975 probably benign Het
Krba1 T C 6: 48,404,039 V103A probably damaging Het
Lcat T C 8: 105,939,664 K409E probably benign Het
Lrriq4 C A 3: 30,659,995 N497K probably benign Het
Mical2 A G 7: 112,320,635 T451A probably damaging Het
Noxo1 C T 17: 24,698,317 probably benign Het
Oas1a A G 5: 120,907,427 I17T probably damaging Het
Otog A T 7: 46,288,768 Y1967F probably benign Het
Pcdha9 A T 18: 36,999,650 N591Y probably damaging Het
Plxna4 A G 6: 32,517,283 Y133H probably damaging Het
Pou5f2 T C 13: 78,024,999 L20P probably benign Het
Prkcb T A 7: 122,600,725 C586* probably null Het
Sema3b A T 9: 107,600,962 M408K probably damaging Het
Serpinf2 G A 11: 75,433,205 T332I probably damaging Het
Tmbim1 A G 1: 74,293,005 V121A probably benign Het
Tph2 C T 10: 115,119,874 G338D probably damaging Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Ttn C T 2: 76,812,552 V13247M probably damaging Het
Uty C T Y: 1,174,825 G192R probably damaging Het
Vmn2r65 G T 7: 84,946,321 P385Q possibly damaging Het
Wdfy3 G A 5: 101,836,274 R3489W probably damaging Het
Zfp750 A G 11: 121,513,732 S106P probably benign Het
Other mutations in Alg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Alg3 APN 16 20607858 missense probably damaging 0.96
IGL01121:Alg3 APN 16 20610647 missense probably damaging 1.00
IGL02121:Alg3 APN 16 20606535 missense possibly damaging 0.55
R6183:Alg3 UTSW 16 20610641 missense probably benign 0.02
R6655:Alg3 UTSW 16 20609026 missense probably benign 0.22
R6831:Alg3 UTSW 16 20608747 missense probably damaging 0.98
R6890:Alg3 UTSW 16 20605986 missense possibly damaging 0.91
R7122:Alg3 UTSW 16 20607852 missense probably damaging 1.00
R7210:Alg3 UTSW 16 20605894 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTTCAGTAGCCGTGGGATC -3'
(R):5'- CACATCCTGGCACTTAATAACCTG -3'

Sequencing Primer
(F):5'- ATCTAAAGTGGCTGCCCAGTG -3'
(R):5'- TCCTGGCACTTAATAACCTGAGGAG -3'
Posted On2016-10-05