Incidental Mutation 'R5488:Abca14'
ID430465
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene NameATP-binding cassette, sub-family A (ABC1), member 14
Synonyms1700110B15Rik, 4930539G24Rik
MMRRC Submission 043049-MU
Accession Numbers

Genbank: NM_026458; MGI: 2388708

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5488 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120203961-120325352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120252250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 817 (V817D)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
Predicted Effect probably damaging
Transcript: ENSMUST00000084640
AA Change: V817D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: V817D

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A G 7: 131,246,595 D710G probably damaging Het
Abca5 A G 11: 110,292,183 V1016A probably benign Het
Ano2 G T 6: 126,039,253 M916I possibly damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Cd48 G A 1: 171,695,705 V39I possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gprc5a T C 6: 135,078,870 V105A probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Kctd3 A G 1: 188,981,366 Y391H probably damaging Het
Kdelr2 T A 5: 143,404,029 I23N probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Lao1 A G 4: 118,967,369 E216G probably damaging Het
Mark4 G T 7: 19,429,607 probably null Het
Mcm10 A G 2: 4,992,118 W851R probably damaging Het
Mettl21e T C 1: 44,218,116 Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,333,446 probably benign Het
Mmp20 A G 9: 7,643,957 probably null Het
Nlrp5 A T 7: 23,417,934 D361V probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr102 T C 17: 37,313,668 T239A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Pcdh10 G A 3: 45,381,368 G706S probably damaging Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Pfkfb3 T C 2: 11,484,669 S273G probably benign Het
Pkn3 T C 2: 30,088,584 probably null Het
Rab40c G A 17: 25,890,669 T78I probably damaging Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc6a11 A G 6: 114,243,894 D462G probably damaging Het
Syne2 A G 12: 75,888,172 T143A probably benign Het
Tardbp A G 4: 148,618,640 F289S probably benign Het
Tdgf1 G A 9: 110,943,197 R44C probably benign Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 95,094,817 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vim A T 2: 13,575,581 T202S probably benign Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Wdr5 T G 2: 27,525,153 D192E probably damaging Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 120246853 missense probably damaging 1.00
IGL00800:Abca14 APN 7 120255390 missense probably benign 0.01
IGL00845:Abca14 APN 7 120223951 splice site probably benign
IGL00897:Abca14 APN 7 120216125 splice site probably benign
IGL01524:Abca14 APN 7 120253421 missense possibly damaging 0.57
IGL01747:Abca14 APN 7 120278087 missense probably benign 0.00
IGL02214:Abca14 APN 7 120294175 missense probably benign 0.09
IGL02215:Abca14 APN 7 120253389 missense probably benign 0.00
IGL02253:Abca14 APN 7 120207959 missense probably benign 0.29
IGL02302:Abca14 APN 7 120318745 splice site probably benign
IGL03391:Abca14 APN 7 120246884 missense probably damaging 1.00
F6893:Abca14 UTSW 7 120325038 missense probably damaging 0.98
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0109:Abca14 UTSW 7 120318762 nonsense probably null
R0265:Abca14 UTSW 7 120223627 missense probably benign 0.03
R0326:Abca14 UTSW 7 120224419 missense probably damaging 1.00
R0380:Abca14 UTSW 7 120278480 missense probably benign 0.03
R0418:Abca14 UTSW 7 120207434 missense probably damaging 1.00
R0539:Abca14 UTSW 7 120207797 missense probably damaging 1.00
R0574:Abca14 UTSW 7 120224497 missense probably damaging 0.96
R0611:Abca14 UTSW 7 120252256 missense possibly damaging 0.63
R0783:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0785:Abca14 UTSW 7 120294157 missense probably damaging 1.00
R0863:Abca14 UTSW 7 120216230 missense probably benign 0.03
R1034:Abca14 UTSW 7 120216147 missense probably damaging 1.00
R1056:Abca14 UTSW 7 120325072 missense probably damaging 1.00
R1072:Abca14 UTSW 7 120212769 missense probably benign
R1244:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1255:Abca14 UTSW 7 120207793 missense probably damaging 0.97
R1271:Abca14 UTSW 7 120325117 missense probably damaging 1.00
R1325:Abca14 UTSW 7 120247322 missense probably benign 0.32
R1457:Abca14 UTSW 7 120289460 missense probably benign 0.00
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1467:Abca14 UTSW 7 120216182 missense possibly damaging 0.80
R1494:Abca14 UTSW 7 120216301 missense probably benign 0.00
R1551:Abca14 UTSW 7 120318878 missense probably benign 0.10
R1607:Abca14 UTSW 7 120251291 missense probably damaging 1.00
R1739:Abca14 UTSW 7 120278306 missense probably benign 0.04
R1856:Abca14 UTSW 7 120278181 missense probably damaging 1.00
R1875:Abca14 UTSW 7 120247967 missense possibly damaging 0.78
R1892:Abca14 UTSW 7 120216338 missense probably benign 0.06
R1898:Abca14 UTSW 7 120251169 missense probably damaging 1.00
R1958:Abca14 UTSW 7 120325159 missense probably damaging 0.98
R2018:Abca14 UTSW 7 120216185 missense probably benign 0.00
R2039:Abca14 UTSW 7 120312264 missense probably damaging 0.98
R2060:Abca14 UTSW 7 120227518 nonsense probably null
R2202:Abca14 UTSW 7 120289541 missense probably benign 0.17
R2205:Abca14 UTSW 7 120247280 missense probably damaging 0.98
R2360:Abca14 UTSW 7 120251208 missense probably benign 0.00
R2401:Abca14 UTSW 7 120283089 missense probably damaging 1.00
R2426:Abca14 UTSW 7 120283223 missense probably benign 0.04
R3433:Abca14 UTSW 7 120294232 missense probably damaging 0.97
R4598:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4599:Abca14 UTSW 7 120255403 missense probably benign 0.11
R4700:Abca14 UTSW 7 120312705 critical splice donor site probably null
R4751:Abca14 UTSW 7 120312177 missense probably benign 0.01
R4826:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4828:Abca14 UTSW 7 120216247 missense probably damaging 1.00
R4837:Abca14 UTSW 7 120246980 missense probably benign
R4881:Abca14 UTSW 7 120278249 missense possibly damaging 0.49
R4895:Abca14 UTSW 7 120247349 critical splice donor site probably null
R4928:Abca14 UTSW 7 120324580 missense possibly damaging 0.90
R4990:Abca14 UTSW 7 120312165 missense probably benign 0.00
R5027:Abca14 UTSW 7 120312282 missense probably benign 0.05
R5091:Abca14 UTSW 7 120252274 missense probably damaging 1.00
R5158:Abca14 UTSW 7 120253429 missense probably benign
R5209:Abca14 UTSW 7 120232907 missense probably benign 0.01
R5333:Abca14 UTSW 7 120289546 nonsense probably null
R5424:Abca14 UTSW 7 120211554 missense probably benign 0.01
R5489:Abca14 UTSW 7 120252250 missense probably damaging 0.98
R5716:Abca14 UTSW 7 120246994 critical splice donor site probably null
R6450:Abca14 UTSW 7 120216226 missense probably benign 0.17
R6477:Abca14 UTSW 7 120325102 missense probably benign 0.44
R6652:Abca14 UTSW 7 120246941 missense probably damaging 1.00
R6782:Abca14 UTSW 7 120248085 missense probably damaging 1.00
R6874:Abca14 UTSW 7 120252205 missense possibly damaging 0.71
R6965:Abca14 UTSW 7 120283229 nonsense probably null
R7142:Abca14 UTSW 7 120251183 missense possibly damaging 0.89
R7146:Abca14 UTSW 7 120255297 missense probably benign 0.15
R7202:Abca14 UTSW 7 120318013 missense probably damaging 1.00
R7220:Abca14 UTSW 7 120227444 missense possibly damaging 0.45
R7241:Abca14 UTSW 7 120246961 missense probably damaging 1.00
R7291:Abca14 UTSW 7 120289609 nonsense probably null
R7296:Abca14 UTSW 7 120278311 missense probably benign
R7298:Abca14 UTSW 7 120207883 missense probably benign 0.00
R7315:Abca14 UTSW 7 120294118 missense probably benign 0.00
R7776:Abca14 UTSW 7 120232991 critical splice donor site probably null
R7820:Abca14 UTSW 7 120212721 missense probably benign 0.42
R7873:Abca14 UTSW 7 120289569 missense probably benign 0.17
R8215:Abca14 UTSW 7 120294202 missense probably benign
R8332:Abca14 UTSW 7 120216213 missense probably benign
Z1088:Abca14 UTSW 7 120216135 missense probably benign 0.14
Z1176:Abca14 UTSW 7 120246923 missense probably damaging 1.00
Z1177:Abca14 UTSW 7 120317987 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGAATTGCACTGCTCAGG -3'
(R):5'- ACTGGATGCTGGAAATCAGAGC -3'

Sequencing Primer
(F):5'- TTGCACTGCTCAGGGAAATTAGC -3'
(R):5'- TCAGAGCACACATGAGGTCGC -3'
Posted On2016-10-05