Incidental Mutation 'R5488:Fam83b'
ID 430472
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Name family with sequence similarity 83, member B
Synonyms C530008M07Rik
MMRRC Submission 043049-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5488 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 76397336-76474398 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76452881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 62 (N62S)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
AlphaFold Q0VBM2
Predicted Effect probably benign
Transcript: ENSMUST00000098546
AA Change: N62S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: N62S

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183437
AA Change: N62S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: N62S

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,851,473 (GRCm39) V817D probably damaging Het
Abca5 A G 11: 110,183,009 (GRCm39) V1016A probably benign Het
Ano2 G T 6: 126,016,216 (GRCm39) M916I possibly damaging Het
Aqr T C 2: 113,963,554 (GRCm39) N632S probably damaging Het
Cd48 G A 1: 171,523,273 (GRCm39) V39I possibly damaging Het
Cdcp3 A G 7: 130,848,324 (GRCm39) D710G probably damaging Het
Cdk17 A G 10: 93,068,274 (GRCm39) T344A probably damaging Het
Chd8 A T 14: 52,450,505 (GRCm39) probably benign Het
Col4a1 A T 8: 11,362,550 (GRCm39) probably benign Het
Col9a3 G A 2: 180,258,318 (GRCm39) R579H probably damaging Het
Cripto G A 9: 110,772,265 (GRCm39) R44C probably benign Het
Cyp2c69 T G 19: 39,839,603 (GRCm39) Q340P probably null Het
D630003M21Rik T A 2: 158,058,941 (GRCm39) T320S probably benign Het
D630045J12Rik A T 6: 38,173,782 (GRCm39) S129T possibly damaging Het
Eif4a3l1 C G 6: 136,306,555 (GRCm39) R339G probably damaging Het
Fam13a A T 6: 59,001,303 (GRCm39) L8Q probably null Het
Foxred1 A T 9: 35,121,266 (GRCm39) V94E probably damaging Het
Gprc5a T C 6: 135,055,868 (GRCm39) V105A probably damaging Het
Gvin3 T A 7: 106,200,797 (GRCm39) noncoding transcript Het
Itga2 A T 13: 114,979,971 (GRCm39) W1077R probably damaging Het
Kat6b A G 14: 21,719,332 (GRCm39) D1228G probably damaging Het
Kctd3 A G 1: 188,713,563 (GRCm39) Y391H probably damaging Het
Kdelr2 T A 5: 143,389,784 (GRCm39) I23N probably damaging Het
Kmt2a A T 9: 44,752,335 (GRCm39) probably benign Het
Lao1 A G 4: 118,824,566 (GRCm39) E216G probably damaging Het
Mark4 G T 7: 19,163,532 (GRCm39) probably null Het
Mcm10 A G 2: 4,996,929 (GRCm39) W851R probably damaging Het
Mettl21e T C 1: 44,257,276 (GRCm39) Y14C probably benign Het
Miga1 CACAACAACAACAACAACA CACAACAACAACAACA 3: 152,039,083 (GRCm39) probably benign Het
Mmp20 A G 9: 7,643,958 (GRCm39) probably null Het
Nlrp5 A T 7: 23,117,359 (GRCm39) D361V probably benign Het
Nrip3 T C 7: 109,361,045 (GRCm39) T210A probably damaging Het
Or12d2 T C 17: 37,624,559 (GRCm39) T239A probably damaging Het
Or52s1b T C 7: 102,822,658 (GRCm39) Y62C probably damaging Het
Pcdh10 G A 3: 45,335,803 (GRCm39) G706S probably damaging Het
Pdzd2 G A 15: 12,382,762 (GRCm39) P1197L probably benign Het
Pfkfb3 T C 2: 11,489,480 (GRCm39) S273G probably benign Het
Pkn3 T C 2: 29,978,596 (GRCm39) probably null Het
Rab40c G A 17: 26,109,643 (GRCm39) T78I probably damaging Het
Rec8 A T 14: 55,860,283 (GRCm39) Q291L probably benign Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sart3 A G 5: 113,909,441 (GRCm39) W86R probably damaging Het
Slc6a11 A G 6: 114,220,855 (GRCm39) D462G probably damaging Het
Syne2 A G 12: 75,934,946 (GRCm39) T143A probably benign Het
Tardbp A G 4: 148,703,097 (GRCm39) F289S probably benign Het
Tdpoz1 T A 3: 93,577,974 (GRCm39) Y270F possibly damaging Het
Tmem117 ACCC ACC 15: 94,992,698 (GRCm39) probably null Het
Trim43a A T 9: 88,464,229 (GRCm39) I47F probably damaging Het
Vim A T 2: 13,580,392 (GRCm39) T202S probably benign Het
Vps13b A T 15: 35,770,688 (GRCm39) I2044L probably benign Het
Wdr5 T G 2: 27,415,165 (GRCm39) D192E probably damaging Het
Zmym2 A G 14: 57,193,712 (GRCm39) K1176E possibly damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76,398,260 (GRCm39) missense probably benign 0.00
IGL01554:Fam83b APN 9 76,409,403 (GRCm39) missense probably benign 0.33
IGL01694:Fam83b APN 9 76,398,272 (GRCm39) missense probably benign 0.13
IGL02009:Fam83b APN 9 76,399,604 (GRCm39) missense probably damaging 1.00
IGL02531:Fam83b APN 9 76,399,282 (GRCm39) missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76,400,324 (GRCm39) missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76,398,434 (GRCm39) missense probably damaging 1.00
R0110:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76,400,108 (GRCm39) missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76,400,210 (GRCm39) nonsense probably null
R0946:Fam83b UTSW 9 76,398,679 (GRCm39) missense probably damaging 0.96
R0961:Fam83b UTSW 9 76,398,577 (GRCm39) missense probably damaging 0.97
R1101:Fam83b UTSW 9 76,452,952 (GRCm39) missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76,399,594 (GRCm39) missense probably damaging 1.00
R1248:Fam83b UTSW 9 76,410,358 (GRCm39) missense probably benign 0.35
R1420:Fam83b UTSW 9 76,399,894 (GRCm39) missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76,399,859 (GRCm39) missense probably benign
R1939:Fam83b UTSW 9 76,400,362 (GRCm39) missense probably damaging 1.00
R1992:Fam83b UTSW 9 76,399,304 (GRCm39) missense probably benign
R2102:Fam83b UTSW 9 76,399,987 (GRCm39) missense probably damaging 0.96
R2134:Fam83b UTSW 9 76,398,298 (GRCm39) missense probably damaging 1.00
R2398:Fam83b UTSW 9 76,409,500 (GRCm39) missense probably damaging 1.00
R2878:Fam83b UTSW 9 76,398,092 (GRCm39) missense probably damaging 1.00
R4092:Fam83b UTSW 9 76,398,943 (GRCm39) missense probably benign 0.24
R4204:Fam83b UTSW 9 76,410,335 (GRCm39) missense probably benign 0.09
R4537:Fam83b UTSW 9 76,399,424 (GRCm39) missense probably benign 0.10
R4920:Fam83b UTSW 9 76,399,150 (GRCm39) missense probably benign
R5456:Fam83b UTSW 9 76,399,877 (GRCm39) missense probably benign
R5473:Fam83b UTSW 9 76,398,782 (GRCm39) missense probably damaging 1.00
R5489:Fam83b UTSW 9 76,452,881 (GRCm39) missense probably benign 0.05
R5876:Fam83b UTSW 9 76,399,132 (GRCm39) missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76,399,639 (GRCm39) missense probably damaging 1.00
R6374:Fam83b UTSW 9 76,400,189 (GRCm39) missense probably benign 0.31
R6468:Fam83b UTSW 9 76,409,413 (GRCm39) nonsense probably null
R6912:Fam83b UTSW 9 76,398,214 (GRCm39) missense probably damaging 0.99
R7022:Fam83b UTSW 9 76,409,394 (GRCm39) frame shift probably null
R7073:Fam83b UTSW 9 76,453,031 (GRCm39) missense probably benign 0.18
R7356:Fam83b UTSW 9 76,400,135 (GRCm39) missense probably benign 0.05
R7665:Fam83b UTSW 9 76,398,157 (GRCm39) missense probably damaging 1.00
R7762:Fam83b UTSW 9 76,399,714 (GRCm39) missense possibly damaging 0.87
R7790:Fam83b UTSW 9 76,399,330 (GRCm39) missense probably benign 0.01
R7869:Fam83b UTSW 9 76,399,426 (GRCm39) missense possibly damaging 0.78
R7879:Fam83b UTSW 9 76,399,737 (GRCm39) missense possibly damaging 0.76
R7957:Fam83b UTSW 9 76,399,267 (GRCm39) missense probably benign 0.00
R8067:Fam83b UTSW 9 76,398,380 (GRCm39) missense probably benign
R8983:Fam83b UTSW 9 76,400,357 (GRCm39) missense probably damaging 1.00
R9361:Fam83b UTSW 9 76,400,076 (GRCm39) missense probably benign 0.03
R9405:Fam83b UTSW 9 76,398,703 (GRCm39) missense possibly damaging 0.93
R9475:Fam83b UTSW 9 76,399,085 (GRCm39) missense probably benign 0.31
R9656:Fam83b UTSW 9 76,452,863 (GRCm39) missense probably benign 0.02
R9690:Fam83b UTSW 9 76,398,502 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAGGTCTATGTGGGTACTCC -3'
(R):5'- GCCCAGATGAACATTTGAAAGTTC -3'

Sequencing Primer
(F):5'- CCTAAGAGTCCGGGCATCAC -3'
(R):5'- CATGGAGGCTTCATCAATGC -3'
Posted On 2016-10-05