Incidental Mutation 'R5499:Olfr366'
ID430499
Institutional Source Beutler Lab
Gene Symbol Olfr366
Ensembl Gene ENSMUSG00000068947
Gene Nameolfactory receptor 366
SynonymsGA_x6K02T2NLDC-33902472-33903401, MOR138-6, MOR138-5P
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5499 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37211574-37224506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37219765 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000150608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091001] [ENSMUST00000214897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000091001
AA Change: I92T

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088524
Gene: ENSMUSG00000068947
AA Change: I92T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5e-62 PFAM
Pfam:7tm_1 41 290 3.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214897
AA Change: I92T

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,601,793 E74K unknown Het
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
Galnt17 T A 5: 130,900,628 Q447L probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Herpud1 C T 8: 94,389,413 L69F probably damaging Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr675 A T 7: 105,024,977 M1K probably null Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Sgcb T C 5: 73,644,405 N39S probably damaging Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn8 C A 11: 83,004,216 S588I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in Olfr366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Olfr366 APN 2 37220026 missense probably damaging 1.00
IGL01925:Olfr366 APN 2 37220046 missense probably benign 0.14
IGL02355:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02362:Olfr366 APN 2 37219669 missense probably damaging 1.00
IGL02671:Olfr366 APN 2 37220245 missense probably damaging 1.00
IGL02821:Olfr366 APN 2 37220100 missense probably damaging 1.00
R0603:Olfr366 UTSW 2 37220106 missense probably damaging 1.00
R0707:Olfr366 UTSW 2 37220196 nonsense probably null
R1204:Olfr366 UTSW 2 37219639 missense probably benign
R1457:Olfr366 UTSW 2 37219659 missense possibly damaging 0.95
R1509:Olfr366 UTSW 2 37219954 missense probably damaging 1.00
R1676:Olfr366 UTSW 2 37219641 nonsense probably null
R1823:Olfr366 UTSW 2 37220332 missense probably damaging 0.96
R2163:Olfr366 UTSW 2 37220077 missense probably damaging 1.00
R2909:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3696:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R3698:Olfr366 UTSW 2 37220176 missense probably damaging 0.98
R4004:Olfr366 UTSW 2 37219948 missense probably benign 0.00
R4655:Olfr366 UTSW 2 37219873 missense probably benign 0.03
R5311:Olfr366 UTSW 2 37219621 missense probably benign 0.00
R5385:Olfr366 UTSW 2 37219587 missense possibly damaging 0.77
R5433:Olfr366 UTSW 2 37219672 missense probably damaging 1.00
R5707:Olfr366 UTSW 2 37219889 missense probably benign 0.00
R6330:Olfr366 UTSW 2 37220124 missense probably benign 0.00
R6338:Olfr366 UTSW 2 37219822 missense probably damaging 1.00
R6666:Olfr366 UTSW 2 37220319 missense probably damaging 1.00
R6872:Olfr366 UTSW 2 37219977 missense possibly damaging 0.60
R7412:Olfr366 UTSW 2 37219762 missense possibly damaging 0.48
R7789:Olfr366 UTSW 2 37219660 missense probably benign 0.01
R7831:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
R7914:Olfr366 UTSW 2 37219711 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGCCATGTACCTGGTCAATG -3'
(R):5'- CGACCCATGAGAATTGTGTGG -3'

Sequencing Primer
(F):5'- ACCTGGTCAATGTGATTGGCAAC -3'
(R):5'- ACCCATGAGAATTGTGTGGGTGAG -3'
Posted On2016-10-05