Incidental Mutation 'R5499:4933409G03Rik'
ID430500
Institutional Source Beutler Lab
Gene Symbol 4933409G03Rik
Ensembl Gene ENSMUSG00000053896
Gene NameRIKEN cDNA 4933409G03 gene
Synonyms
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5499 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location68582413-68616463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68601793 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 74 (E74K)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102713]
Predicted Effect unknown
Transcript: ENSMUST00000102713
AA Change: E93K
SMART Domains Protein: ENSMUSP00000099774
Gene: ENSMUSG00000053896
AA Change: E93K

DomainStartEndE-ValueType
low complexity region 74 86 N/A INTRINSIC
low complexity region 89 133 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
low complexity region 293 305 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137117
AA Change: E74K
SMART Domains Protein: ENSMUSP00000117165
Gene: ENSMUSG00000053896
AA Change: E74K

DomainStartEndE-ValueType
low complexity region 56 68 N/A INTRINSIC
low complexity region 71 115 N/A INTRINSIC
low complexity region 176 188 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
Galnt17 T A 5: 130,900,628 Q447L probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Herpud1 C T 8: 94,389,413 L69F probably damaging Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr366 T C 2: 37,219,765 I92T possibly damaging Het
Olfr675 A T 7: 105,024,977 M1K probably null Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Sgcb T C 5: 73,644,405 N39S probably damaging Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn8 C A 11: 83,004,216 S588I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in 4933409G03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:4933409G03Rik APN 2 68601898 missense unknown
IGL00514:4933409G03Rik APN 2 68601797 missense unknown
IGL02173:4933409G03Rik APN 2 68613057 missense unknown
IGL02252:4933409G03Rik APN 2 68614334 splice site probably benign
PIT4812001:4933409G03Rik UTSW 2 68588948 missense probably benign 0.16
R0196:4933409G03Rik UTSW 2 68616247 unclassified probably benign
R1939:4933409G03Rik UTSW 2 68588984 missense possibly damaging 0.83
R2422:4933409G03Rik UTSW 2 68591520 missense probably benign 0.16
R3435:4933409G03Rik UTSW 2 68601845 missense unknown
R4124:4933409G03Rik UTSW 2 68616224 unclassified probably benign
R4243:4933409G03Rik UTSW 2 68593543 intron probably benign
R4424:4933409G03Rik UTSW 2 68615147 unclassified probably benign
R4649:4933409G03Rik UTSW 2 68606215 missense unknown
R4650:4933409G03Rik UTSW 2 68606215 missense unknown
R4651:4933409G03Rik UTSW 2 68606215 missense unknown
R4652:4933409G03Rik UTSW 2 68606215 missense unknown
R4653:4933409G03Rik UTSW 2 68606215 missense unknown
R4732:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R4733:4933409G03Rik UTSW 2 68614721 unclassified probably benign
R5144:4933409G03Rik UTSW 2 68616260 unclassified probably benign
R5828:4933409G03Rik UTSW 2 68601800 missense unknown
R5936:4933409G03Rik UTSW 2 68615504 unclassified probably benign
R6323:4933409G03Rik UTSW 2 68606224 missense unknown
R7491:4933409G03Rik UTSW 2 68614755 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAGGTTACTGTGCATTCCTTGG -3'
(R):5'- GGCTGGTGCTACACTAGTAAAC -3'

Sequencing Primer
(F):5'- GTTTCTAGATATTGATACAGGGAC -3'
(R):5'- CTGGTGCTACACTAGTAAACAGAAG -3'
Posted On2016-10-05