Incidental Mutation 'R5499:Sgcb'
ID430511
Institutional Source Beutler Lab
Gene Symbol Sgcb
Ensembl Gene ENSMUSG00000029156
Gene Namesarcoglycan, beta (dystrophin-associated glycoprotein)
Synonymsbeta-SG
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5499 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73632749-73647790 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73644405 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 39 (N39S)
Ref Sequence ENSEMBL: ENSMUSP00000079937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081170]
Predicted Effect probably damaging
Transcript: ENSMUST00000081170
AA Change: N39S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079937
Gene: ENSMUSG00000029156
AA Change: N39S

DomainStartEndE-ValueType
Pfam:Sarcoglycan_1 56 305 4.3e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201845
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sarcoglycan family. Sarcoglycans are transmembrane components in the dystrophin-glycoprotein complex which help stabilize the muscle fiber membranes and link the muscle cytoskeleton to the extracellular matrix. Mutations in this gene have been associated with limb-girdle muscular dystrophy.[provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit muscular dystrophy and cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,601,793 E74K unknown Het
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
Galnt17 T A 5: 130,900,628 Q447L probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Herpud1 C T 8: 94,389,413 L69F probably damaging Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr366 T C 2: 37,219,765 I92T possibly damaging Het
Olfr675 A T 7: 105,024,977 M1K probably null Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn8 C A 11: 83,004,216 S588I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in Sgcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sgcb APN 5 73635678 missense possibly damaging 0.92
IGL02504:Sgcb APN 5 73644375 missense probably damaging 0.96
IGL03330:Sgcb APN 5 73639869 missense probably damaging 1.00
PIT4445001:Sgcb UTSW 5 73639812 missense probably damaging 0.99
R0708:Sgcb UTSW 5 73640882 splice site probably null
R1016:Sgcb UTSW 5 73639840 missense probably benign 0.18
R1119:Sgcb UTSW 5 73644414 missense probably damaging 1.00
R1293:Sgcb UTSW 5 73635527 missense probably benign 0.13
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R1464:Sgcb UTSW 5 73635553 missense probably benign 0.05
R2762:Sgcb UTSW 5 73635709 splice site probably null
R6120:Sgcb UTSW 5 73640810 missense possibly damaging 0.62
R6809:Sgcb UTSW 5 73640693 missense probably benign 0.03
R7484:Sgcb UTSW 5 73639845 missense possibly damaging 0.86
R7647:Sgcb UTSW 5 73639377 splice site probably null
R8797:Sgcb UTSW 5 73635693 missense probably benign 0.00
R8939:Sgcb UTSW 5 73644318 missense probably damaging 0.98
Z1177:Sgcb UTSW 5 73644285 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTCTTCCAAGGTACCTCCAGAG -3'
(R):5'- TGAAACCTGCAATTCAGTGTG -3'

Sequencing Primer
(F):5'- TTCCAAGGTACCTCCAGAGAGAGG -3'
(R):5'- ACCTGCAATTCAGTGTGACTTG -3'
Posted On2016-10-05