Incidental Mutation 'R5499:Galnt17'
ID430513
Institutional Source Beutler Lab
Gene Symbol Galnt17
Ensembl Gene ENSMUSG00000034040
Gene Namepolypeptide N-acetylgalactosaminyltransferase 17
SynonymsE330012B09Rik, Wbscr17, Galnt19, Gcap8
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5499 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location130872082-131308497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130900628 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 447 (Q447L)
Ref Sequence ENSEMBL: ENSMUSP00000083187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086023]
Predicted Effect probably benign
Transcript: ENSMUST00000086023
AA Change: Q447L

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000083187
Gene: ENSMUSG00000034040
AA Change: Q447L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glycos_transf_2 155 341 9.6e-31 PFAM
Pfam:Glyco_tranf_2_2 155 394 7.8e-8 PFAM
RICIN 465 594 9.77e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201486
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N-acetylgalactosaminyltransferase. This gene is located centromeric to the common deleted region in Williams-Beuren syndrome (WBS), a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. This protein may play a role in membrane trafficking. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,601,793 E74K unknown Het
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Herpud1 C T 8: 94,389,413 L69F probably damaging Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr366 T C 2: 37,219,765 I92T possibly damaging Het
Olfr675 A T 7: 105,024,977 M1K probably null Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Sgcb T C 5: 73,644,405 N39S probably damaging Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn8 C A 11: 83,004,216 S588I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in Galnt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01690:Galnt17 APN 5 131085896 critical splice donor site probably null
IGL02312:Galnt17 APN 5 131306533 missense probably benign 0.09
IGL02744:Galnt17 APN 5 131111775 missense probably damaging 0.99
IGL03066:Galnt17 APN 5 130900648 missense probably benign
R0744:Galnt17 UTSW 5 131150916 missense probably damaging 1.00
R1186:Galnt17 UTSW 5 131111742 missense probably damaging 0.98
R1784:Galnt17 UTSW 5 131150963 missense probably benign 0.35
R1909:Galnt17 UTSW 5 131111838 missense probably benign 0.03
R1969:Galnt17 UTSW 5 131150944 missense probably benign 0.19
R2102:Galnt17 UTSW 5 131085993 missense probably damaging 1.00
R2158:Galnt17 UTSW 5 130906702 missense probably damaging 1.00
R2307:Galnt17 UTSW 5 130900622 missense probably damaging 1.00
R2680:Galnt17 UTSW 5 131111823 missense probably damaging 0.97
R4549:Galnt17 UTSW 5 131150937 missense probably damaging 1.00
R4938:Galnt17 UTSW 5 131306399 missense probably benign
R5030:Galnt17 UTSW 5 130876513 missense probably damaging 0.98
R5134:Galnt17 UTSW 5 130964035 missense probably damaging 1.00
R5518:Galnt17 UTSW 5 130900590 missense probably damaging 1.00
R5662:Galnt17 UTSW 5 131086006 missense probably damaging 1.00
R5806:Galnt17 UTSW 5 130877819 missense probably damaging 1.00
R6209:Galnt17 UTSW 5 131081596 missense probably benign 0.01
R6751:Galnt17 UTSW 5 131081590 missense probably damaging 0.99
R7205:Galnt17 UTSW 5 131306752 start gained probably benign
R7212:Galnt17 UTSW 5 130964111 missense possibly damaging 0.69
R7529:Galnt17 UTSW 5 131306380 missense probably damaging 0.99
R8881:Galnt17 UTSW 5 130877797 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTATGACTTGGGCAGATAACAAAGCC -3'
(R):5'- TACCTCAAAGCATTCCAGGCTC -3'

Sequencing Primer
(F):5'- AAGCCACGGTCCCATTCCTG -3'
(R):5'- GGCTCCAACTCCCCTAGATG -3'
Posted On2016-10-05