Incidental Mutation 'R5499:Dnai7'
ID 430514
Institutional Source Beutler Lab
Gene Symbol Dnai7
Ensembl Gene ENSMUSG00000043541
Gene Name dynein axonemal intermediate chain 7
Synonyms Las1, A230084G12Rik, Casc1
MMRRC Submission 043060-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5499 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 145120560-145156731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 145123157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 570 (W570R)
Ref Sequence ENSEMBL: ENSMUSP00000144783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: W570R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: W570R

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: W557R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: W557R

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141307
Predicted Effect probably damaging
Transcript: ENSMUST00000204105
AA Change: W570R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541
AA Change: W570R

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,432,137 (GRCm39) E74K unknown Het
Adam10 A T 9: 70,647,399 (GRCm39) H176L probably benign Het
Anapc5 C T 5: 122,926,476 (GRCm39) E621K probably damaging Het
Asf1a T A 10: 53,482,266 (GRCm39) L26Q probably damaging Het
Atxn1l A G 8: 110,458,264 (GRCm39) L666P probably damaging Het
Cep290 G A 10: 100,373,515 (GRCm39) R1265H probably damaging Het
Chd8 A G 14: 52,441,888 (GRCm39) probably null Het
Ctse T A 1: 131,600,251 (GRCm39) Y333* probably null Het
Diras2 C T 13: 52,661,786 (GRCm39) V174M probably benign Het
Dnah11 A T 12: 118,070,209 (GRCm39) V1532D possibly damaging Het
Ercc6 G A 14: 32,238,916 (GRCm39) M1I probably null Het
Fbxl4 A G 4: 22,386,017 (GRCm39) E208G probably damaging Het
Fstl4 G T 11: 52,959,374 (GRCm39) M138I probably benign Het
Galnt17 T A 5: 130,929,466 (GRCm39) Q447L probably benign Het
H2-Q7 T A 17: 35,658,916 (GRCm39) C122* probably null Het
Herpud1 C T 8: 95,116,041 (GRCm39) L69F probably damaging Het
Hnrnpa3 A G 2: 75,495,584 (GRCm39) Y365C probably benign Het
Ino80 A T 2: 119,272,128 (GRCm39) V553E probably damaging Het
Kif13a A G 13: 46,986,212 (GRCm39) Y38H probably damaging Het
Klk1b21 A G 7: 43,755,100 (GRCm39) I132V probably benign Het
Lamb2 T C 9: 108,365,001 (GRCm39) S1252P possibly damaging Het
Lct T A 1: 128,214,414 (GRCm39) D1786V probably damaging Het
Lrig2 T A 3: 104,368,873 (GRCm39) M572L probably benign Het
Lrp1 C T 10: 127,408,813 (GRCm39) V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 (GRCm39) S250R probably benign Het
Mycbp2 T C 14: 103,479,615 (GRCm39) D1226G probably damaging Het
Myocd A G 11: 65,069,575 (GRCm39) I755T possibly damaging Het
Nup210l T C 3: 90,081,677 (GRCm39) L1003P probably damaging Het
Or11h23 G A 14: 50,948,324 (GRCm39) C179Y probably damaging Het
Or1af1 T C 2: 37,109,777 (GRCm39) I92T possibly damaging Het
Or52e8b A T 7: 104,674,184 (GRCm39) M1K probably null Het
Palmd T A 3: 116,717,481 (GRCm39) M339L probably benign Het
Phtf1 T A 3: 103,898,491 (GRCm39) N307K probably benign Het
Ppp2r3c T C 12: 55,335,411 (GRCm39) I243V probably benign Het
Ptafr A G 4: 132,306,646 (GRCm39) E12G probably damaging Het
Rpgrip1 T A 14: 52,378,042 (GRCm39) N463K probably benign Het
Sgcb T C 5: 73,801,748 (GRCm39) N39S probably damaging Het
Skint5 A G 4: 113,799,700 (GRCm39) probably null Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Slfn8 C A 11: 82,895,042 (GRCm39) S588I probably damaging Het
Tcea2 A G 2: 181,322,227 (GRCm39) I10V probably damaging Het
Tlr3 C T 8: 45,851,851 (GRCm39) D349N possibly damaging Het
Top2a C T 11: 98,913,202 (GRCm39) V77I probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Vrk1 A G 12: 106,018,024 (GRCm39) K98E possibly damaging Het
Zcchc2 C T 1: 105,958,322 (GRCm39) T931I possibly damaging Het
Zfc3h1 T A 10: 115,246,598 (GRCm39) L895H probably damaging Het
Zfp101 T C 17: 33,601,318 (GRCm39) E108G probably benign Het
Zfp609 A G 9: 65,610,137 (GRCm39) V942A probably benign Het
Other mutations in Dnai7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dnai7 APN 6 145,121,016 (GRCm39) missense probably benign 0.00
IGL00586:Dnai7 APN 6 145,137,302 (GRCm39) missense possibly damaging 0.53
IGL01066:Dnai7 APN 6 145,121,948 (GRCm39) missense probably damaging 0.96
IGL01413:Dnai7 APN 6 145,120,812 (GRCm39) missense probably damaging 1.00
IGL02275:Dnai7 APN 6 145,123,090 (GRCm39) missense probably damaging 1.00
IGL02668:Dnai7 APN 6 145,150,983 (GRCm39) missense unknown
IGL03018:Dnai7 APN 6 145,129,031 (GRCm39) missense probably damaging 1.00
IGL03233:Dnai7 APN 6 145,127,611 (GRCm39) missense probably damaging 1.00
R0011:Dnai7 UTSW 6 145,124,781 (GRCm39) missense probably damaging 1.00
R0011:Dnai7 UTSW 6 145,124,781 (GRCm39) missense probably damaging 1.00
R0180:Dnai7 UTSW 6 145,128,944 (GRCm39) critical splice donor site probably benign
R0786:Dnai7 UTSW 6 145,127,483 (GRCm39) critical splice donor site probably null
R1916:Dnai7 UTSW 6 145,121,926 (GRCm39) missense probably benign 0.37
R2117:Dnai7 UTSW 6 145,150,967 (GRCm39) critical splice donor site probably null
R2174:Dnai7 UTSW 6 145,120,896 (GRCm39) missense probably damaging 1.00
R2264:Dnai7 UTSW 6 145,154,155 (GRCm39) utr 5 prime probably benign
R4393:Dnai7 UTSW 6 145,140,304 (GRCm39) missense possibly damaging 0.49
R4467:Dnai7 UTSW 6 145,128,944 (GRCm39) critical splice donor site probably null
R4847:Dnai7 UTSW 6 145,120,911 (GRCm39) missense probably damaging 1.00
R5014:Dnai7 UTSW 6 145,128,992 (GRCm39) missense probably damaging 1.00
R5207:Dnai7 UTSW 6 145,124,794 (GRCm39) missense probably damaging 1.00
R5264:Dnai7 UTSW 6 145,127,502 (GRCm39) missense probably benign 0.02
R5359:Dnai7 UTSW 6 145,142,618 (GRCm39) missense probably damaging 1.00
R6211:Dnai7 UTSW 6 145,146,217 (GRCm39) missense probably damaging 1.00
R6579:Dnai7 UTSW 6 145,124,744 (GRCm39) missense probably benign 0.19
R6939:Dnai7 UTSW 6 145,120,945 (GRCm39) missense possibly damaging 0.46
R7108:Dnai7 UTSW 6 145,131,591 (GRCm39) nonsense probably null
R7131:Dnai7 UTSW 6 145,123,132 (GRCm39) missense probably null 0.97
R7810:Dnai7 UTSW 6 145,140,312 (GRCm39) missense probably benign 0.28
R8017:Dnai7 UTSW 6 145,140,283 (GRCm39) missense probably damaging 1.00
R8385:Dnai7 UTSW 6 145,120,918 (GRCm39) missense probably damaging 1.00
R8680:Dnai7 UTSW 6 145,127,542 (GRCm39) missense probably benign 0.13
R8720:Dnai7 UTSW 6 145,150,983 (GRCm39) missense unknown
R9118:Dnai7 UTSW 6 145,120,971 (GRCm39) missense probably damaging 1.00
R9118:Dnai7 UTSW 6 145,120,900 (GRCm39) missense probably damaging 1.00
R9172:Dnai7 UTSW 6 145,123,175 (GRCm39) missense probably benign
R9290:Dnai7 UTSW 6 145,148,688 (GRCm39) missense unknown
X0063:Dnai7 UTSW 6 145,120,997 (GRCm39) missense probably benign 0.13
Z1176:Dnai7 UTSW 6 145,151,019 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTTAGCTGAGAGGAACCTGGG -3'
(R):5'- AGCTTCCAGAAGAGTCCCAAG -3'

Sequencing Primer
(F):5'- TCCTGGTGTTTTCCCTGACACAG -3'
(R):5'- GACAGACCAGAGGCATTATTTAGTG -3'
Posted On 2016-10-05