Incidental Mutation 'R5499:Herpud1'
ID430518
Institutional Source Beutler Lab
Gene Symbol Herpud1
Ensembl Gene ENSMUSG00000031770
Gene Namehomocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
SynonymsHerp, Mifl
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.316) question?
Stock #R5499 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94386438-94395377 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94389413 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 69 (L69F)
Ref Sequence ENSEMBL: ENSMUSP00000124201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034220] [ENSMUST00000161085] [ENSMUST00000161576] [ENSMUST00000211982]
Predicted Effect probably damaging
Transcript: ENSMUST00000034220
AA Change: L69F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034220
Gene: ENSMUSG00000031770
AA Change: L69F

DomainStartEndE-ValueType
UBQ 10 86 1.99e-13 SMART
low complexity region 216 242 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160866
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161024
Predicted Effect unknown
Transcript: ENSMUST00000161085
AA Change: S29F
Predicted Effect probably damaging
Transcript: ENSMUST00000161576
AA Change: L69F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124201
Gene: ENSMUSG00000031770
AA Change: L69F

DomainStartEndE-ValueType
UBQ 10 87 7.55e-14 SMART
low complexity region 217 243 N/A INTRINSIC
low complexity region 274 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211982
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the ER stress response. This response includes the inhibition of translation to prevent further accumulation of unfolded proteins, the increased expression of proteins involved in polypeptide folding, known as the unfolded protein response (UPR), and the destruction of misfolded proteins by the ER-associated protein degradation (ERAD) system. This gene may play a role in both UPR and ERAD. Its expression is induced by UPR and it has an ER stress response element in its promoter region while the encoded protein has an N-terminal ubiquitin-like domain which may interact with the ERAD system. This protein has been shown to interact with presenilin proteins and to increase the level of amyloid-beta protein following its overexpression. Alternative splicing of this gene produces multiple transcript variants encoding different isoforms. The full-length nature of all transcript variants has not been determined. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired glucose tolerance and decreased cerebral infarction size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,601,793 E74K unknown Het
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
Galnt17 T A 5: 130,900,628 Q447L probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr366 T C 2: 37,219,765 I92T possibly damaging Het
Olfr675 A T 7: 105,024,977 M1K probably null Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Sgcb T C 5: 73,644,405 N39S probably damaging Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slfn8 C A 11: 83,004,216 S588I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in Herpud1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:Herpud1 APN 8 94394642 nonsense probably null
R1667:Herpud1 UTSW 8 94389366 missense probably damaging 1.00
R2015:Herpud1 UTSW 8 94392206 missense probably benign 0.44
R2255:Herpud1 UTSW 8 94394613 missense probably benign 0.06
R3707:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R4940:Herpud1 UTSW 8 94390842 missense probably benign 0.18
R4961:Herpud1 UTSW 8 94390826 missense probably benign 0.00
R4981:Herpud1 UTSW 8 94391794 missense probably damaging 1.00
R5214:Herpud1 UTSW 8 94390851 splice site probably null
R5835:Herpud1 UTSW 8 94392239 missense probably damaging 1.00
R5985:Herpud1 UTSW 8 94390794 missense probably damaging 1.00
R6702:Herpud1 UTSW 8 94392526 critical splice donor site probably null
R6794:Herpud1 UTSW 8 94394770 intron probably null
R7060:Herpud1 UTSW 8 94390763 missense probably benign 0.04
R7100:Herpud1 UTSW 8 94390847 missense probably damaging 0.98
R7328:Herpud1 UTSW 8 94386620 missense possibly damaging 0.76
R7384:Herpud1 UTSW 8 94389377 missense probably damaging 0.98
R7898:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R7981:Herpud1 UTSW 8 94392200 missense probably benign 0.05
R8025:Herpud1 UTSW 8 94392521 missense probably damaging 1.00
R8036:Herpud1 UTSW 8 94392386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGAAAGAAGTTTCCCTGTG -3'
(R):5'- ATGCCATACCTTTGTGCTGG -3'

Sequencing Primer
(F):5'- TCCCTGTGAATAAGAAGTAAAGTGTG -3'
(R):5'- CCATACCTTTGTGCTGGTTTCTGG -3'
Posted On2016-10-05