Incidental Mutation 'R5499:Slfn8'
ID430530
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Nameschlafen 8
Synonyms
MMRRC Submission 043060-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5499 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83002158-83020810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83004216 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 588 (S588I)
Ref Sequence ENSEMBL: ENSMUSP00000114417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
Predicted Effect probably damaging
Transcript: ENSMUST00000038141
AA Change: S588I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: S588I

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092838
AA Change: S588I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: S588I

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130822
AA Change: S588I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: S588I

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000131883
AA Change: S364I
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: S364I

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933409G03Rik G A 2: 68,601,793 E74K unknown Het
Adam10 A T 9: 70,740,117 H176L probably benign Het
Anapc5 C T 5: 122,788,413 E621K probably damaging Het
Asf1a T A 10: 53,606,170 L26Q probably damaging Het
Atxn1l A G 8: 109,731,632 L666P probably damaging Het
Casc1 A T 6: 145,177,431 W570R probably damaging Het
Cep290 G A 10: 100,537,653 R1265H probably damaging Het
Chd8 A G 14: 52,204,431 probably null Het
Ctse T A 1: 131,672,513 Y333* probably null Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Ercc6 G A 14: 32,516,959 M1I probably null Het
Fbxl4 A G 4: 22,386,017 E208G probably damaging Het
Fstl4 G T 11: 53,068,547 M138I probably benign Het
Galnt17 T A 5: 130,900,628 Q447L probably benign Het
H2-Q7 T A 17: 35,439,940 C122* probably null Het
Herpud1 C T 8: 94,389,413 L69F probably damaging Het
Hnrnpa3 A G 2: 75,665,240 Y365C probably benign Het
Ino80 A T 2: 119,441,647 V553E probably damaging Het
Kif13a A G 13: 46,832,736 Y38H probably damaging Het
Klk1b21 A G 7: 44,105,676 I132V probably benign Het
Lamb2 T C 9: 108,487,802 S1252P possibly damaging Het
Lct T A 1: 128,286,677 D1786V probably damaging Het
Lrig2 T A 3: 104,461,557 M572L probably benign Het
Lrp1 C T 10: 127,572,944 V1710I possibly damaging Het
Mmp12 C A 9: 7,353,000 S250R probably benign Het
Mycbp2 T C 14: 103,242,179 D1226G probably damaging Het
Myocd A G 11: 65,178,749 I755T possibly damaging Het
Nup210l T C 3: 90,174,370 L1003P probably damaging Het
Olfr366 T C 2: 37,219,765 I92T possibly damaging Het
Olfr675 A T 7: 105,024,977 M1K probably null Het
Olfr748 G A 14: 50,710,867 C179Y probably damaging Het
Palmd T A 3: 116,923,832 M339L probably benign Het
Phtf1 T A 3: 103,991,175 N307K probably benign Het
Ppp2r3c T C 12: 55,288,626 I243V probably benign Het
Ptafr A G 4: 132,579,335 E12G probably damaging Het
Rpgrip1 T A 14: 52,140,585 N463K probably benign Het
Sgcb T C 5: 73,644,405 N39S probably damaging Het
Skint5 A G 4: 113,942,503 probably null Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tcea2 A G 2: 181,680,434 I10V probably damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Top2a C T 11: 99,022,376 V77I probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Vrk1 A G 12: 106,051,765 K98E possibly damaging Het
Zcchc2 C T 1: 106,030,592 T931I possibly damaging Het
Zfc3h1 T A 10: 115,410,693 L895H probably damaging Het
Zfp101 T C 17: 33,382,344 E108G probably benign Het
Zfp609 A G 9: 65,702,855 V942A probably benign Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 83013484 missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 83004636 missense probably damaging 1.00
IGL01620:Slfn8 APN 11 83004233 nonsense probably null
IGL01875:Slfn8 APN 11 83004079 missense probably benign 0.30
IGL01896:Slfn8 APN 11 83003696 missense probably damaging 1.00
IGL01929:Slfn8 APN 11 83003405 nonsense probably null
IGL02111:Slfn8 APN 11 83004498 missense probably damaging 1.00
IGL02136:Slfn8 APN 11 83003465 nonsense probably null
IGL02165:Slfn8 APN 11 83017196 missense probably benign 0.00
IGL02645:Slfn8 APN 11 83003554 missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 83003691 missense probably damaging 1.00
IGL02689:Slfn8 APN 11 83017108 missense probably damaging 1.00
IGL02948:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03037:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03185:Slfn8 APN 11 83017507 missense probably benign 0.01
IGL03243:Slfn8 APN 11 83003707 missense probably damaging 1.00
IGL03286:Slfn8 APN 11 83013468 missense probably damaging 0.99
R0295:Slfn8 UTSW 11 83003343 nonsense probably null
R0368:Slfn8 UTSW 11 83017132 missense probably damaging 1.00
R0382:Slfn8 UTSW 11 83004556 missense probably damaging 1.00
R0655:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R0894:Slfn8 UTSW 11 83003581 missense probably benign 0.07
R1006:Slfn8 UTSW 11 83003511 missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 83016745 missense probably benign 0.19
R1187:Slfn8 UTSW 11 83003488 missense probably damaging 1.00
R1501:Slfn8 UTSW 11 83003180 missense probably damaging 0.99
R1646:Slfn8 UTSW 11 83016886 missense probably damaging 1.00
R1909:Slfn8 UTSW 11 83003621 nonsense probably null
R2005:Slfn8 UTSW 11 83004150 missense probably damaging 1.00
R2363:Slfn8 UTSW 11 83004094 missense probably damaging 1.00
R3780:Slfn8 UTSW 11 83017454 missense probably benign 0.13
R3890:Slfn8 UTSW 11 83004444 missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 83016993 nonsense probably null
R4559:Slfn8 UTSW 11 83004744 missense probably damaging 1.00
R4684:Slfn8 UTSW 11 83017506 missense probably benign 0.10
R4767:Slfn8 UTSW 11 83003197 missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 83017393 missense probably damaging 1.00
R4859:Slfn8 UTSW 11 83017714 start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 83016878 missense probably damaging 1.00
R4939:Slfn8 UTSW 11 83003285 missense probably benign 0.01
R5107:Slfn8 UTSW 11 83017150 missense probably damaging 0.99
R5130:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R5165:Slfn8 UTSW 11 83017127 missense probably damaging 0.99
R5238:Slfn8 UTSW 11 83013388 missense probably damaging 0.96
R5282:Slfn8 UTSW 11 83017724 critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 83004084 missense probably damaging 1.00
R5617:Slfn8 UTSW 11 83004721 missense probably benign 0.01
R5782:Slfn8 UTSW 11 83017041 missense probably damaging 0.98
R5823:Slfn8 UTSW 11 83016736 missense probably benign 0.01
R5886:Slfn8 UTSW 11 83003334 missense probably benign 0.09
R5933:Slfn8 UTSW 11 83003335 missense probably benign 0.00
R6151:Slfn8 UTSW 11 83017321 missense probably damaging 1.00
R6163:Slfn8 UTSW 11 83003864 makesense probably null
R6191:Slfn8 UTSW 11 83016800 missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 83004055 unclassified probably null
R6925:Slfn8 UTSW 11 83013417 nonsense probably null
R7065:Slfn8 UTSW 11 83016968 missense probably benign 0.01
R7380:Slfn8 UTSW 11 83003740 missense not run
R7414:Slfn8 UTSW 11 83016792 nonsense probably null
R7819:Slfn8 UTSW 11 83004255 missense probably damaging 1.00
X0021:Slfn8 UTSW 11 83016928 missense possibly damaging 0.69
Z1177:Slfn8 UTSW 11 83003533 missense not run
Predicted Primers PCR Primer
(F):5'- AGATCCAAACACTTACCGGATG -3'
(R):5'- GGTTCTCTGCCTGAGTTCTCAG -3'

Sequencing Primer
(F):5'- ATGAAGTCCCTCAATGGCTG -3'
(R):5'- GCCTGAGTTCTCAGAACAATATTGAG -3'
Posted On2016-10-05