Mutagenetix > Incidental Mutations

Incidental Mutation 'R5500:Klhl41'

430553

Institutional Source

Beutler Lab

Gene Symbol

Klhl41

Ensembl Gene

ENSMUSG00000075307

Gene Name

kelch-like 41

Synonyms

LOC228003, Kbtbd10

MMRRC Submission

043061-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R5500 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69670120-69684230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69683529 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 584 (E584G)

Ref Sequence

ENSEMBL: ENSMUSP00000097627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073152] [ENSMUST00000100050] [ENSMUST00000102706]

Predicted Effect

probably benign
Transcript: ENSMUST00000073152

SMART Domains

Protein: ENSMUSP00000072896
Gene: ENSMUSG00000027086

Domain	Start	End	E-Value	Type
low complexity region	179	191	N/A	INTRINSIC
low complexity region	316	324	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
Pfam:FAST_1	560	628	6.6e-25	PFAM
Pfam:FAST_2	645	730	6.4e-26	PFAM
RAP	763	822	4.38e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100050
AA Change: E584G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: E584G

Domain	Start	End	E-Value	Type
BTB	33	130	8.34e-27	SMART
BACK	135	237	9.67e-36	SMART
Kelch	346	398	6.71e-1	SMART
Kelch	399	447	1.56e-5	SMART
Kelch	448	495	2.43e-7	SMART
Kelch	496	542	5.81e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102706

SMART Domains

Protein: ENSMUSP00000099767
Gene: ENSMUSG00000027086

Domain	Start	End	E-Value	Type
low complexity region	179	191	N/A	INTRINSIC
low complexity region	316	324	N/A	INTRINSIC
low complexity region	385	396	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
Pfam:FAST_1	530	600	2.2e-26	PFAM
Pfam:FAST_2	614	701	4.4e-31	PFAM
RAP	734	793	4.38e-25	SMART

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,303,389	Q864L	probably benign	Het
AI182371	A	G	2: 35,100,638	S16P	probably damaging	Het
Amy1	A	T	3: 113,562,722	Y262N	probably damaging	Het
Cdh23	T	C	10: 60,314,311	D2583G	probably damaging	Het
Ddx60	A	G	8: 61,950,451	K303E	probably benign	Het
Dis3l2	T	C	1: 87,021,119		probably null	Het
Evi5l	T	A	8: 4,191,658	M329K	probably damaging	Het
Fam169b	A	G	7: 68,350,369	D221G	probably damaging	Het
Farsb	T	C	1: 78,471,124	D126G	probably damaging	Het
Gm4847	A	G	1: 166,635,042	I293T	probably damaging	Het
Gm4951	G	A	18: 60,246,020	R209H	probably damaging	Het
Ighmbp2	T	C	19: 3,268,687	H463R	possibly damaging	Het
Kank1	A	T	19: 25,424,332	D1101V	possibly damaging	Het
Kcnh8	G	A	17: 52,725,980	M98I	probably benign	Het
Kdsr	A	G	1: 106,759,644		probably benign	Het
Kif18b	A	T	11: 102,915,700	V107E	probably damaging	Het
Kpnb1	G	A	11: 97,173,111	A389V	possibly damaging	Het
Krtap31-2	A	G	11: 99,936,347	T2A	possibly damaging	Het
Lama3	A	T	18: 12,456,764	I784F	possibly damaging	Het
Lpar1	G	A	4: 58,486,573	R233C	probably benign	Het
Neb	C	A	2: 52,162,067		probably null	Het
Neo1	A	G	9: 58,917,054	I697T	possibly damaging	Het
Pgm2l1	T	G	7: 100,268,133	S486A	probably benign	Het
Prpf40a	A	T	2: 53,145,284	S748R	probably benign	Het
Recql4	A	G	15: 76,705,578		probably benign	Het
Rhbdl1	T	C	17: 25,836,554	T20A	possibly damaging	Het
Ric8a	T	C	7: 140,858,315	Y156H	probably benign	Het
Rnf111	C	A	9: 70,476,043	G203C	possibly damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc2a12	G	A	10: 22,665,137	G297E	probably damaging	Het
Slc35f1	A	T	10: 52,933,222	I102F	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slitrk3	T	C	3: 73,050,347	Y364C	probably damaging	Het
Tdrd9	T	C	12: 112,023,268	Y505H	probably benign	Het
Tlr1	G	T	5: 64,927,098	D45E	probably benign	Het
Upp1	G	A	11: 9,131,774	V104M	probably damaging	Het
Usp9y	A	G	Y: 1,341,875	V1330A	probably damaging	Het
Wdyhv1	T	C	15: 58,152,610	V85A	possibly damaging	Het
Zbed5	T	A	5: 129,901,982	Y257*	probably null	Het

Other mutations in Klhl41

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01316:Klhl41	APN	2	69674724	missense	probably benign	0.00
IGL01622:Klhl41	APN	2	69678238	missense	probably benign	0.05
IGL01623:Klhl41	APN	2	69678238	missense	probably benign	0.05
IGL03237:Klhl41	APN	2	69670558	missense	possibly damaging	0.94
R0220:Klhl41	UTSW	2	69670485	missense	probably benign	0.25
R0277:Klhl41	UTSW	2	69671296	missense	probably damaging	1.00
R0456:Klhl41	UTSW	2	69670549	missense	probably damaging	0.99
R0485:Klhl41	UTSW	2	69671256	missense	probably damaging	0.97
R0536:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0537:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0552:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0553:Klhl41	UTSW	2	69670210	missense	probably benign	0.04
R0834:Klhl41	UTSW	2	69678147	missense	possibly damaging	0.76
R0879:Klhl41	UTSW	2	69683483	unclassified	probably benign
R1531:Klhl41	UTSW	2	69670740	missense	probably benign	0.03
R1678:Klhl41	UTSW	2	69670939	missense	probably benign	0.01
R1792:Klhl41	UTSW	2	69670802	missense	probably benign	0.01
R1900:Klhl41	UTSW	2	69674619	splice site	probably benign
R2012:Klhl41	UTSW	2	69683496	missense	possibly damaging	0.61
R4041:Klhl41	UTSW	2	69670710	missense	probably benign	0.00
R5223:Klhl41	UTSW	2	69679827	nonsense	probably null
R5643:Klhl41	UTSW	2	69670471	missense	probably damaging	1.00
R5644:Klhl41	UTSW	2	69670471	missense	probably damaging	1.00
R5656:Klhl41	UTSW	2	69683532	missense	possibly damaging	0.89
R6264:Klhl41	UTSW	2	69679832	critical splice donor site	probably null
R6678:Klhl41	UTSW	2	69670844	missense	probably benign	0.04
R6731:Klhl41	UTSW	2	69674700	missense	probably damaging	1.00
R7586:Klhl41	UTSW	2	69674724	missense	probably benign	0.33
R7664:Klhl41	UTSW	2	69670717	missense	probably damaging	1.00
X0021:Klhl41	UTSW	2	69679706	missense	probably damaging	1.00
Z1088:Klhl41	UTSW	2	69674730	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CACTTTGTCTGGGTAGGAAGC -3'
(R):5'- AAACTGCGTGAATCCCTGTAAC -3'

Sequencing Primer
(F):5'- TCTGGGTAGGAAGCGGTAGGAC -3'
(R):5'- GAATCCCTGTAACCCTATGTGAATC -3'

Posted On

2016-10-05