Mutagenetix > Incidental Mutation

Incidental Mutation 'R5500:Slitrk3'

430555

Institutional Source

Beutler Lab

Gene Symbol

Slitrk3

Ensembl Gene

ENSMUSG00000048304

Gene Name

SLIT and NTRK-like family, member 3

Synonyms

MMRRC Submission

043061-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.733) question?

Stock #

R5500 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73047265-73057803 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73050347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 364 (Y364C)

Ref Sequence

ENSEMBL: ENSMUSP00000141236 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]

AlphaFold

Q810B9

Predicted Effect

probably damaging
Transcript: ENSMUST00000059407
AA Change: Y364C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: Y364C

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000192477
AA Change: Y364C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: Y364C

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	A	T	13: 77,303,389	Q864L	probably benign	Het
AI182371	A	G	2: 35,100,638	S16P	probably damaging	Het
Amy1	A	T	3: 113,562,722	Y262N	probably damaging	Het
Cdh23	T	C	10: 60,314,311	D2583G	probably damaging	Het
Ddx60	A	G	8: 61,950,451	K303E	probably benign	Het
Dis3l2	T	C	1: 87,021,119		probably null	Het
Evi5l	T	A	8: 4,191,658	M329K	probably damaging	Het
Fam169b	A	G	7: 68,350,369	D221G	probably damaging	Het
Farsb	T	C	1: 78,471,124	D126G	probably damaging	Het
Gm4847	A	G	1: 166,635,042	I293T	probably damaging	Het
Gm4951	G	A	18: 60,246,020	R209H	probably damaging	Het
Ighmbp2	T	C	19: 3,268,687	H463R	possibly damaging	Het
Kank1	A	T	19: 25,424,332	D1101V	possibly damaging	Het
Kcnh8	G	A	17: 52,725,980	M98I	probably benign	Het
Kdsr	A	G	1: 106,759,644		probably benign	Het
Kif18b	A	T	11: 102,915,700	V107E	probably damaging	Het
Klhl41	A	G	2: 69,683,529	E584G	probably damaging	Het
Kpnb1	G	A	11: 97,173,111	A389V	possibly damaging	Het
Krtap31-2	A	G	11: 99,936,347	T2A	possibly damaging	Het
Lama3	A	T	18: 12,456,764	I784F	possibly damaging	Het
Lpar1	G	A	4: 58,486,573	R233C	probably benign	Het
Neb	C	A	2: 52,162,067		probably null	Het
Neo1	A	G	9: 58,917,054	I697T	possibly damaging	Het
Pgm2l1	T	G	7: 100,268,133	S486A	probably benign	Het
Prpf40a	A	T	2: 53,145,284	S748R	probably benign	Het
Recql4	A	G	15: 76,705,578		probably benign	Het
Rhbdl1	T	C	17: 25,836,554	T20A	possibly damaging	Het
Ric8a	T	C	7: 140,858,315	Y156H	probably benign	Het
Rnf111	C	A	9: 70,476,043	G203C	possibly damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc2a12	G	A	10: 22,665,137	G297E	probably damaging	Het
Slc35f1	A	T	10: 52,933,222	I102F	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Tdrd9	T	C	12: 112,023,268	Y505H	probably benign	Het
Tlr1	G	T	5: 64,927,098	D45E	probably benign	Het
Upp1	G	A	11: 9,131,774	V104M	probably damaging	Het
Usp9y	A	G	Y: 1,341,875	V1330A	probably damaging	Het
Wdyhv1	T	C	15: 58,152,610	V85A	possibly damaging	Het
Zbed5	T	A	5: 129,901,982	Y257*	probably null	Het

Other mutations in Slitrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Slitrk3	APN	3	73051103	missense	probably damaging	1.00
IGL00857:Slitrk3	APN	3	73049841	missense	probably damaging	1.00
IGL00990:Slitrk3	APN	3	73050081	missense	probably damaging	1.00
IGL01010:Slitrk3	APN	3	73049273	missense	probably benign	0.14
IGL01299:Slitrk3	APN	3	73049016	missense	probably benign	0.43
IGL01609:Slitrk3	APN	3	73050237	missense	probably damaging	1.00
IGL01881:Slitrk3	APN	3	73049306	missense	probably benign	0.00
IGL01941:Slitrk3	APN	3	73051071	missense	possibly damaging	0.72
IGL02183:Slitrk3	APN	3	73049979	missense	probably damaging	0.97
IGL02187:Slitrk3	APN	3	73050272	missense	probably damaging	1.00
IGL02478:Slitrk3	APN	3	73050713	missense	probably damaging	0.96
IGL02512:Slitrk3	APN	3	73050402	missense	probably benign	0.28
IGL02720:Slitrk3	APN	3	73050768	missense	probably damaging	1.00
IGL03113:Slitrk3	APN	3	73050390	missense	probably benign	0.00
IGL03224:Slitrk3	APN	3	73049930	missense	possibly damaging	0.72
wee	UTSW	3	73050785	missense	probably damaging	1.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0639:Slitrk3	UTSW	3	73049649	missense	probably benign	0.02
R1448:Slitrk3	UTSW	3	73050341	missense	probably damaging	0.99
R1656:Slitrk3	UTSW	3	73050339	missense	probably damaging	0.98
R1713:Slitrk3	UTSW	3	73049691	missense	probably benign	0.00
R1992:Slitrk3	UTSW	3	73049771	missense	possibly damaging	0.80
R1999:Slitrk3	UTSW	3	73049964	missense	probably benign	0.13
R2359:Slitrk3	UTSW	3	73049345	missense	possibly damaging	0.56
R3083:Slitrk3	UTSW	3	73048595	missense	probably benign	0.00
R3153:Slitrk3	UTSW	3	73048982	nonsense	probably null
R3821:Slitrk3	UTSW	3	73049216	missense	possibly damaging	0.94
R4208:Slitrk3	UTSW	3	73051157	missense	possibly damaging	0.67
R4323:Slitrk3	UTSW	3	73050785	missense	probably damaging	1.00
R4580:Slitrk3	UTSW	3	73051206	missense	probably damaging	0.96
R4730:Slitrk3	UTSW	3	73049519	missense	probably benign	0.08
R4742:Slitrk3	UTSW	3	73048565	missense	probably benign	0.00
R4979:Slitrk3	UTSW	3	73049796	missense	possibly damaging	0.95
R5018:Slitrk3	UTSW	3	73050512	missense	probably benign	0.31
R5023:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5057:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5156:Slitrk3	UTSW	3	73049259	missense	probably benign
R5582:Slitrk3	UTSW	3	73050404	missense	probably benign	0.09
R5797:Slitrk3	UTSW	3	73048629	missense	probably damaging	0.99
R5963:Slitrk3	UTSW	3	73050713	missense	probably benign	0.30
R5985:Slitrk3	UTSW	3	73050900	missense	probably damaging	1.00
R6123:Slitrk3	UTSW	3	73049762	missense	probably damaging	1.00
R6393:Slitrk3	UTSW	3	73049914	missense	possibly damaging	0.79
R6529:Slitrk3	UTSW	3	73051218	missense	probably benign	0.02
R6584:Slitrk3	UTSW	3	73049225	missense	probably damaging	0.99
R6645:Slitrk3	UTSW	3	73049861	missense	probably benign	0.13
R7001:Slitrk3	UTSW	3	73050609	nonsense	probably null
R7282:Slitrk3	UTSW	3	73050465	missense	possibly damaging	0.70
R7534:Slitrk3	UTSW	3	73050107	missense	probably damaging	0.98
R7577:Slitrk3	UTSW	3	73051115	missense	probably damaging	0.99
R7757:Slitrk3	UTSW	3	73050839	missense	probably damaging	1.00
R8251:Slitrk3	UTSW	3	73049396	missense	possibly damaging	0.67
R8354:Slitrk3	UTSW	3	73049180	missense	probably benign	0.08
R8454:Slitrk3	UTSW	3	73049180	missense	probably benign	0.08
R8488:Slitrk3	UTSW	3	73051187	missense	probably benign	0.02
R8491:Slitrk3	UTSW	3	73051259	missense	possibly damaging	0.89
R8843:Slitrk3	UTSW	3	73048831	missense	probably benign	0.04
R9140:Slitrk3	UTSW	3	73050459	missense	probably benign	0.02
R9451:Slitrk3	UTSW	3	73051283	missense	possibly damaging	0.83
R9511:Slitrk3	UTSW	3	73050939	missense	possibly damaging	0.46
R9575:Slitrk3	UTSW	3	73048794	missense	probably benign	0.00
R9589:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R9603:Slitrk3	UTSW	3	73051316	missense	probably benign	0.00
X0022:Slitrk3	UTSW	3	73050266	missense	probably damaging	1.00
Z1176:Slitrk3	UTSW	3	73048770	missense	probably benign	0.09
Z1177:Slitrk3	UTSW	3	73049142	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCCCTAGGTGCAAGAGATCC -3'
(R):5'- TGGCCAACTAAACCTTCCTC -3'

Sequencing Primer
(F):5'- CCAAAAATCAGAGCGGTATATCTTC -3'
(R):5'- GGCCAACTAAACCTTCCTCTATGTTG -3'

Posted On

2016-10-05