Incidental Mutation 'R5500:Zbed5'
ID430560
Institutional Source Beutler Lab
Gene Symbol Zbed5
Ensembl Gene ENSMUSG00000034173
Gene Namezinc finger, BED type containing 5
Synonyms2410018M08Rik
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location129895723-129903623 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 129901982 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 257 (Y257*)
Ref Sequence ENSEMBL: ENSMUSP00000044533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041466] [ENSMUST00000077320] [ENSMUST00000140667]
Predicted Effect probably null
Transcript: ENSMUST00000041466
AA Change: Y257*
SMART Domains Protein: ENSMUSP00000044533
Gene: ENSMUSG00000034173
AA Change: Y257*

DomainStartEndE-ValueType
low complexity region 16 51 N/A INTRINSIC
low complexity region 60 75 N/A INTRINSIC
Pfam:DUF4371 281 412 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077320
SMART Domains Protein: ENSMUSP00000116455
Gene: ENSMUSG00000034173

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 39 54 N/A INTRINSIC
Pfam:CHCH 95 128 2.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140667
SMART Domains Protein: ENSMUSP00000117510
Gene: ENSMUSG00000025537

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 20 143 4.1e-9 PFAM
Pfam:Pkinase 20 144 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202430
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is unusual in that its coding sequence is mostly derived from Charlie-like DNA transposon; however, it does not appear to be an active DNA transposon as it is not flanked by terminal inverted repeats. The encoded protein is conserved among the mammalian Laurasiatheria branch. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Other mutations in Zbed5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Zbed5 APN 5 129902133 unclassified probably null
IGL03334:Zbed5 APN 5 129902355 missense possibly damaging 0.66
R0449:Zbed5 UTSW 5 129901726 missense probably damaging 1.00
R0744:Zbed5 UTSW 5 129902272 missense possibly damaging 0.92
R0763:Zbed5 UTSW 5 129902179 missense probably benign 0.00
R1967:Zbed5 UTSW 5 129901669 missense possibly damaging 0.68
R2246:Zbed5 UTSW 5 129902751 missense probably benign 0.01
R2925:Zbed5 UTSW 5 129903198 missense possibly damaging 0.66
R3053:Zbed5 UTSW 5 129902146 missense possibly damaging 0.66
R3701:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3702:Zbed5 UTSW 5 129903159 missense possibly damaging 0.90
R3916:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R3917:Zbed5 UTSW 5 129902277 missense possibly damaging 0.92
R4547:Zbed5 UTSW 5 129902851 nonsense probably null
R4548:Zbed5 UTSW 5 129902851 nonsense probably null
R5195:Zbed5 UTSW 5 129902178 missense probably benign 0.01
R5813:Zbed5 UTSW 5 129902218 missense possibly damaging 0.46
R6377:Zbed5 UTSW 5 129903369 missense possibly damaging 0.83
R6620:Zbed5 UTSW 5 129903289 missense possibly damaging 0.82
R6862:Zbed5 UTSW 5 129903185 missense probably benign
R6931:Zbed5 UTSW 5 129903329 nonsense probably null
R7223:Zbed5 UTSW 5 129900438 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAGTGGACCATCCCAGGC -3'
(R):5'- ATTTCCTGGACCACCTGATCAAG -3'

Sequencing Primer
(F):5'- GGTTTTACCTCAACCATCACAGTAGG -3'
(R):5'- TGGACCACCTGATCAAGAATATCAG -3'
Posted On2016-10-05