Incidental Mutation 'R5500:Pgm2l1'
ID430563
Institutional Source Beutler Lab
Gene Symbol Pgm2l1
Ensembl Gene ENSMUSG00000030729
Gene Namephosphoglucomutase 2-like 1
Synonyms4931406N15Rik, BM32A
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R5500 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location100227394-100278868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 100268133 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 486 (S486A)
Ref Sequence ENSEMBL: ENSMUSP00000081998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054436] [ENSMUST00000084935] [ENSMUST00000162108]
Predicted Effect probably benign
Transcript: ENSMUST00000054436
AA Change: S486A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000054782
Gene: ENSMUSG00000030729
AA Change: S486A

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 64 212 2.5e-36 PFAM
Pfam:PGM_PMM_II 237 347 2e-25 PFAM
Pfam:PGM_PMM_III 353 481 5.4e-15 PFAM
Pfam:PGM_PMM_IV 524 604 5.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084935
AA Change: S486A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081998
Gene: ENSMUSG00000030729
AA Change: S486A

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 64 212 4e-36 PFAM
Pfam:PGM_PMM_II 237 347 2.4e-26 PFAM
Pfam:PGM_PMM_III 353 481 8e-16 PFAM
Pfam:PGM_PMM_IV 526 601 8.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160622
Predicted Effect probably benign
Transcript: ENSMUST00000162108
SMART Domains Protein: ENSMUSP00000124851
Gene: ENSMUSG00000030729

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 64 212 4e-37 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Pgm2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Pgm2l1 APN 7 100255619 critical splice donor site probably null
R0044:Pgm2l1 UTSW 7 100250332 missense probably benign 0.01
R0044:Pgm2l1 UTSW 7 100250332 missense probably benign 0.01
R0106:Pgm2l1 UTSW 7 100250373 missense probably benign 0.07
R0106:Pgm2l1 UTSW 7 100250373 missense probably benign 0.07
R0394:Pgm2l1 UTSW 7 100252198 missense probably damaging 1.00
R1518:Pgm2l1 UTSW 7 100261725 missense probably benign 0.00
R2184:Pgm2l1 UTSW 7 100268155 missense possibly damaging 0.82
R2207:Pgm2l1 UTSW 7 100268112 splice site probably null
R2344:Pgm2l1 UTSW 7 100259908 missense probably damaging 0.99
R3804:Pgm2l1 UTSW 7 100252267 missense probably benign 0.00
R4292:Pgm2l1 UTSW 7 100250301 missense probably damaging 1.00
R4789:Pgm2l1 UTSW 7 100267587 missense probably benign
R4872:Pgm2l1 UTSW 7 100227997 missense probably damaging 1.00
R5001:Pgm2l1 UTSW 7 100272376 missense probably benign 0.00
R5081:Pgm2l1 UTSW 7 100268265 missense probably benign
R5181:Pgm2l1 UTSW 7 100261758 missense probably benign 0.01
R5417:Pgm2l1 UTSW 7 100272376 missense probably benign 0.00
R6057:Pgm2l1 UTSW 7 100266674 missense probably benign 0.33
R6414:Pgm2l1 UTSW 7 100255540 missense possibly damaging 0.88
R7356:Pgm2l1 UTSW 7 100268119 missense possibly damaging 0.94
R7658:Pgm2l1 UTSW 7 100250328 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAACAGACCTGCCTTGCTTG -3'
(R):5'- TGAGCACACTGGCTTGGATC -3'

Sequencing Primer
(F):5'- TCGAACTCATGGAGATCTGC -3'
(R):5'- CACTGGCTTGGATCTTAGGTGAAAC -3'
Posted On2016-10-05