Mutagenetix > Incidental Mutation

Incidental Mutation 'R5500:2210408I21Rik'

430576

Institutional Source

Beutler Lab

Gene Symbol

2210408I21Rik

Ensembl Gene

ENSMUSG00000071252

Gene Name

RIKEN cDNA 2210408I21 gene

Synonyms

MMRRC Submission

043061-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5500 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77135540-77613784 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77303389 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 864 (Q864L)

Ref Sequence

ENSEMBL: ENSMUSP00000127449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168779]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000168779
AA Change: Q864L

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: Q864L

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	151	164	N/A	INTRINSIC
Pfam:DUF4495	515	832	1.6e-140	PFAM
low complexity region	1241	1255	N/A	INTRINSIC

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI182371	A	G	2: 35,100,638	S16P	probably damaging	Het
Amy1	A	T	3: 113,562,722	Y262N	probably damaging	Het
Cdh23	T	C	10: 60,314,311	D2583G	probably damaging	Het
Ddx60	A	G	8: 61,950,451	K303E	probably benign	Het
Dis3l2	T	C	1: 87,021,119		probably null	Het
Evi5l	T	A	8: 4,191,658	M329K	probably damaging	Het
Fam169b	A	G	7: 68,350,369	D221G	probably damaging	Het
Farsb	T	C	1: 78,471,124	D126G	probably damaging	Het
Gm4847	A	G	1: 166,635,042	I293T	probably damaging	Het
Gm4951	G	A	18: 60,246,020	R209H	probably damaging	Het
Ighmbp2	T	C	19: 3,268,687	H463R	possibly damaging	Het
Kank1	A	T	19: 25,424,332	D1101V	possibly damaging	Het
Kcnh8	G	A	17: 52,725,980	M98I	probably benign	Het
Kdsr	A	G	1: 106,759,644		probably benign	Het
Kif18b	A	T	11: 102,915,700	V107E	probably damaging	Het
Klhl41	A	G	2: 69,683,529	E584G	probably damaging	Het
Kpnb1	G	A	11: 97,173,111	A389V	possibly damaging	Het
Krtap31-2	A	G	11: 99,936,347	T2A	possibly damaging	Het
Lama3	A	T	18: 12,456,764	I784F	possibly damaging	Het
Lpar1	G	A	4: 58,486,573	R233C	probably benign	Het
Neb	C	A	2: 52,162,067		probably null	Het
Neo1	A	G	9: 58,917,054	I697T	possibly damaging	Het
Pgm2l1	T	G	7: 100,268,133	S486A	probably benign	Het
Prpf40a	A	T	2: 53,145,284	S748R	probably benign	Het
Recql4	A	G	15: 76,705,578		probably benign	Het
Rhbdl1	T	C	17: 25,836,554	T20A	possibly damaging	Het
Ric8a	T	C	7: 140,858,315	Y156H	probably benign	Het
Rnf111	C	A	9: 70,476,043	G203C	possibly damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc2a12	G	A	10: 22,665,137	G297E	probably damaging	Het
Slc35f1	A	T	10: 52,933,222	I102F	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slitrk3	T	C	3: 73,050,347	Y364C	probably damaging	Het
Tdrd9	T	C	12: 112,023,268	Y505H	probably benign	Het
Tlr1	G	T	5: 64,927,098	D45E	probably benign	Het
Upp1	G	A	11: 9,131,774	V104M	probably damaging	Het
Usp9y	A	G	Y: 1,341,875	V1330A	probably damaging	Het
Wdyhv1	T	C	15: 58,152,610	V85A	possibly damaging	Het
Zbed5	T	A	5: 129,901,982	Y257*	probably null	Het

Other mutations in 2210408I21Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:2210408I21Rik	APN	13	77323358	splice site	probably benign
IGL01154:2210408I21Rik	APN	13	77281094	missense	probably benign	0.01
IGL01461:2210408I21Rik	APN	13	77281095	missense	probably benign	0.25
IGL01624:2210408I21Rik	APN	13	77193086	missense	probably damaging	0.99
IGL02033:2210408I21Rik	APN	13	77259876	missense	possibly damaging	0.90
IGL02621:2210408I21Rik	APN	13	77260031	missense	possibly damaging	0.92
IGL02718:2210408I21Rik	APN	13	77174872	missense	probably damaging	1.00
IGL02823:2210408I21Rik	APN	13	77261955	missense	probably damaging	0.96
IGL02859:2210408I21Rik	APN	13	77267699	missense	possibly damaging	0.71
IGL03006:2210408I21Rik	APN	13	77323772	critical splice donor site	probably null
IGL03072:2210408I21Rik	APN	13	77259997	missense	probably benign
IGL03184:2210408I21Rik	APN	13	77323451	missense	possibly damaging	0.63
IGL03275:2210408I21Rik	APN	13	77298555	missense	possibly damaging	0.71
PIT4651001:2210408I21Rik	UTSW	13	77259895	missense	probably benign
R0226:2210408I21Rik	UTSW	13	77303425	missense	possibly damaging	0.86
R0323:2210408I21Rik	UTSW	13	77298555	missense	possibly damaging	0.71
R0614:2210408I21Rik	UTSW	13	77192663	missense	probably benign	0.26
R0894:2210408I21Rik	UTSW	13	77323607	missense	probably benign	0.18
R1165:2210408I21Rik	UTSW	13	77334287	missense	probably benign	0.06
R1509:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R1711:2210408I21Rik	UTSW	13	77269920	missense	possibly damaging	0.93
R1714:2210408I21Rik	UTSW	13	77316360	missense	possibly damaging	0.86
R1718:2210408I21Rik	UTSW	13	77245370	intron	probably benign
R1836:2210408I21Rik	UTSW	13	77323374	missense	probably benign	0.00
R1893:2210408I21Rik	UTSW	13	77267809	missense	possibly damaging	0.93
R2035:2210408I21Rik	UTSW	13	77612642	makesense	probably null
R2329:2210408I21Rik	UTSW	13	77303325	missense	probably benign	0.04
R2897:2210408I21Rik	UTSW	13	77323521	missense	probably benign	0.33
R3688:2210408I21Rik	UTSW	13	77267849	missense	possibly damaging	0.52
R4153:2210408I21Rik	UTSW	13	77193173	missense	probably benign	0.00
R4387:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4388:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4499:2210408I21Rik	UTSW	13	77316527	missense	possibly damaging	0.96
R4614:2210408I21Rik	UTSW	13	77254256	splice site	probably null
R4798:2210408I21Rik	UTSW	13	77323724	missense	possibly damaging	0.96
R4943:2210408I21Rik	UTSW	13	77245327	missense	possibly damaging	0.86
R5045:2210408I21Rik	UTSW	13	77267808	splice site	probably null
R5387:2210408I21Rik	UTSW	13	77259973	missense	probably benign	0.11
R5686:2210408I21Rik	UTSW	13	77303314	missense	possibly damaging	0.72
R6111:2210408I21Rik	UTSW	13	77327902	missense	possibly damaging	0.72
R6135:2210408I21Rik	UTSW	13	77254216	missense	probably damaging	0.98
R6188:2210408I21Rik	UTSW	13	77183731	missense	possibly damaging	0.53
R6388:2210408I21Rik	UTSW	13	77262111	missense	probably benign
R6588:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R6632:2210408I21Rik	UTSW	13	77281067	missense	possibly damaging	0.86
R6638:2210408I21Rik	UTSW	13	77303402	missense	probably benign	0.07
R6755:2210408I21Rik	UTSW	13	77327875	missense	probably benign
R6971:2210408I21Rik	UTSW	13	77193187	missense	possibly damaging	0.90
R7079:2210408I21Rik	UTSW	13	77254204	missense	possibly damaging	0.86
R7130:2210408I21Rik	UTSW	13	77269902	missense	possibly damaging	0.93
R7215:2210408I21Rik	UTSW	13	77323571	missense	possibly damaging	0.96
R7272:2210408I21Rik	UTSW	13	77323536	missense	probably benign	0.00
R7331:2210408I21Rik	UTSW	13	77183609	missense	possibly damaging	0.53
R7561:2210408I21Rik	UTSW	13	77193195	missense	probably benign
R7684:2210408I21Rik	UTSW	13	77612540	nonsense	probably null
R7728:2210408I21Rik	UTSW	13	77316477	missense	possibly damaging	0.96
R7881:2210408I21Rik	UTSW	13	77323566	missense	possibly damaging	0.53
R7963:2210408I21Rik	UTSW	13	77192554	missense	probably benign	0.02
R8008:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8024:2210408I21Rik	UTSW	13	77612594	missense	probably benign
R8170:2210408I21Rik	UTSW	13	77263594	missense	probably benign	0.06
R8201:2210408I21Rik	UTSW	13	77193159	missense	possibly damaging	0.72
R8255:2210408I21Rik	UTSW	13	77267731	missense	possibly damaging	0.71
R8296:2210408I21Rik	UTSW	13	77267777	missense	probably damaging	0.98
R8476:2210408I21Rik	UTSW	13	77261901	missense	possibly damaging	0.92
R8526:2210408I21Rik	UTSW	13	77269816	nonsense	probably null
R8746:2210408I21Rik	UTSW	13	77303410	missense	probably benign	0.01
R8812:2210408I21Rik	UTSW	13	77332352	missense	probably damaging	0.98
R8870:2210408I21Rik	UTSW	13	77323721	missense	possibly damaging	0.96
R8885:2210408I21Rik	UTSW	13	77323406	missense	possibly damaging	0.91
R8910:2210408I21Rik	UTSW	13	77323649	missense	probably benign	0.03
R8911:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8965:2210408I21Rik	UTSW	13	77612604	missense	probably benign	0.02
R8968:2210408I21Rik	UTSW	13	77332310	nonsense	probably null
R8989:2210408I21Rik	UTSW	13	77612605	missense	probably benign	0.01
R9163:2210408I21Rik	UTSW	13	77245281	missense	possibly damaging	0.73
R9378:2210408I21Rik	UTSW	13	77323616	missense	possibly damaging	0.53
R9478:2210408I21Rik	UTSW	13	77303454	missense	possibly damaging	0.53
R9523:2210408I21Rik	UTSW	13	77259869	missense	possibly damaging	0.53
R9595:2210408I21Rik	UTSW	13	77316447	missense	probably benign
X0066:2210408I21Rik	UTSW	13	77183640	missense	possibly damaging	0.72
Z1088:2210408I21Rik	UTSW	13	77174891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAACTGCACTAAGAAGCAAGTG -3'
(R):5'- CCAAACAGAAGCTCTATAAGATGCATG -3'

Sequencing Primer
(F):5'- CTGCACTAAGAAGCAAGTGTATGTC -3'
(R):5'- TTTACAAACAAGAGTCAGAAAAGCTC -3'

Posted On

2016-10-05