Incidental Mutation 'R5500:Sh3bp5'
ID430577
Institutional Source Beutler Lab
Gene Symbol Sh3bp5
Ensembl Gene ENSMUSG00000021892
Gene NameSH3-domain binding protein 5 (BTK-associated)
SynonymsSab
MMRRC Submission 043061-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R5500 (G1)
Quality Score209
Status Not validated
Chromosome14
Chromosomal Location31359880-31436078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31377495 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 265 (R265L)
Ref Sequence ENSEMBL: ENSMUSP00000117152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002]
Predicted Effect probably benign
Transcript: ENSMUST00000091903
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
AA Change: R263L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892
AA Change: R263L

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147586
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A T 13: 77,303,389 Q864L probably benign Het
AI182371 A G 2: 35,100,638 S16P probably damaging Het
Amy1 A T 3: 113,562,722 Y262N probably damaging Het
Cdh23 T C 10: 60,314,311 D2583G probably damaging Het
Ddx60 A G 8: 61,950,451 K303E probably benign Het
Dis3l2 T C 1: 87,021,119 probably null Het
Evi5l T A 8: 4,191,658 M329K probably damaging Het
Fam169b A G 7: 68,350,369 D221G probably damaging Het
Farsb T C 1: 78,471,124 D126G probably damaging Het
Gm4847 A G 1: 166,635,042 I293T probably damaging Het
Gm4951 G A 18: 60,246,020 R209H probably damaging Het
Ighmbp2 T C 19: 3,268,687 H463R possibly damaging Het
Kank1 A T 19: 25,424,332 D1101V possibly damaging Het
Kcnh8 G A 17: 52,725,980 M98I probably benign Het
Kdsr A G 1: 106,759,644 probably benign Het
Kif18b A T 11: 102,915,700 V107E probably damaging Het
Klhl41 A G 2: 69,683,529 E584G probably damaging Het
Kpnb1 G A 11: 97,173,111 A389V possibly damaging Het
Krtap31-2 A G 11: 99,936,347 T2A possibly damaging Het
Lama3 A T 18: 12,456,764 I784F possibly damaging Het
Lpar1 G A 4: 58,486,573 R233C probably benign Het
Neb C A 2: 52,162,067 probably null Het
Neo1 A G 9: 58,917,054 I697T possibly damaging Het
Pgm2l1 T G 7: 100,268,133 S486A probably benign Het
Prpf40a A T 2: 53,145,284 S748R probably benign Het
Recql4 A G 15: 76,705,578 probably benign Het
Rhbdl1 T C 17: 25,836,554 T20A possibly damaging Het
Ric8a T C 7: 140,858,315 Y156H probably benign Het
Rnf111 C A 9: 70,476,043 G203C possibly damaging Het
Slc2a12 G A 10: 22,665,137 G297E probably damaging Het
Slc35f1 A T 10: 52,933,222 I102F probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Slitrk3 T C 3: 73,050,347 Y364C probably damaging Het
Tdrd9 T C 12: 112,023,268 Y505H probably benign Het
Tlr1 G T 5: 64,927,098 D45E probably benign Het
Upp1 G A 11: 9,131,774 V104M probably damaging Het
Usp9y A G Y: 1,341,875 V1330A probably damaging Het
Wdyhv1 T C 15: 58,152,610 V85A possibly damaging Het
Zbed5 T A 5: 129,901,982 Y257* probably null Het
Other mutations in Sh3bp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Sh3bp5 APN 14 31379390 nonsense probably null
IGL02828:Sh3bp5 APN 14 31434149 splice site probably benign
R1925:Sh3bp5 UTSW 14 31435923 missense probably benign
R2511:Sh3bp5 UTSW 14 31411629 missense probably damaging 1.00
R4798:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R4799:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5303:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5306:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5307:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5308:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5400:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5401:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5402:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5421:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5422:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5496:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5498:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5687:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5688:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5724:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5762:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5765:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5862:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5938:Sh3bp5 UTSW 14 31387834 missense possibly damaging 0.65
R5940:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R5941:Sh3bp5 UTSW 14 31377495 missense probably benign 0.06
R6516:Sh3bp5 UTSW 14 31375672 missense possibly damaging 0.84
R6935:Sh3bp5 UTSW 14 31379516 missense probably damaging 0.96
R7309:Sh3bp5 UTSW 14 31378289 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ATCAAATGAGCACAGCGTCC -3'
(R):5'- TGTTGTAATCATGTGTCACCCC -3'

Sequencing Primer
(F):5'- AGCGTCCCACAATACATGAG -3'
(R):5'- ATGTGTCACCCCCTCCATCAG -3'
Posted On2016-10-05