Incidental Mutation 'R5501:Serpinb13'
ID 430591
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5501 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106982185 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 11 (F11L)
Ref Sequence ENSEMBL: ENSMUSP00000118572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably benign
Transcript: ENSMUST00000027564
AA Change: F11L

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: F11L

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136766
AA Change: F11L

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: F11L

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 107000789 missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 107000435 missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106995789 missense probably benign 0.01
R9350:Serpinb13 UTSW 1 106995832 nonsense probably null
R9375:Serpinb13 UTSW 1 106982267 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAAGGAGTGGGCAGTAGTTC -3'
(R):5'- TCATCAGCAGGTCAAGTTGCAC -3'

Sequencing Primer
(F):5'- TCTGAGGGTCAGGAATAACAGTGTTC -3'
(R):5'- GCAGGTCAAGTTGCACACATTTTC -3'
Posted On 2016-10-05