Mutagenetix > Incidental Mutation

Incidental Mutation 'R5501:Eef2k'

430609

Institutional Source

Beutler Lab

Gene Symbol

Eef2k

Ensembl Gene

ENSMUSG00000035064

Gene Name

eukaryotic elongation factor-2 kinase

Synonyms

eEF-2K

MMRRC Submission

043062-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120842831-120907450 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120889248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 452 (D452G)

Ref Sequence

ENSEMBL: ENSMUSP00000102098 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]

AlphaFold

O08796

Predicted Effect

probably benign
Transcript: ENSMUST00000047875
AA Change: D452G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: D452G

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	525	562	7.2e-5	PFAM
Pfam:Sel1	564	608	2.9e-3	PFAM
Pfam:Sel1	609	645	1.3e-1	PFAM
Pfam:Sel1	665	699	1.2e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106487

SMART Domains

Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	1e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
Pfam:Sel1	432	472	1.8e-3	PFAM
Pfam:Sel1	474	518	7.2e-3	PFAM
Pfam:Sel1	519	555	8e-2	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106488
AA Change: D452G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: D452G

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	522	562	1.1e-3	PFAM
Pfam:Sel1	564	608	3.9e-3	PFAM
Pfam:Sel1	609	645	4.8e-2	PFAM
Pfam:Sel1	664	699	4.6e-3	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106489
AA Change: D452G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: D452G

Domain	Start	End	E-Value	Type
Blast:Alpha_kinase	5	81	2e-12	BLAST
Alpha_kinase	120	317	7.75e-109	SMART
low complexity region	358	376	N/A	INTRINSIC
Pfam:Sel1	522	562	1.1e-3	PFAM
Pfam:Sel1	564	608	3.9e-3	PFAM
Pfam:Sel1	609	645	4.8e-2	PFAM
Pfam:Sel1	664	699	4.6e-3	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128813

Predicted Effect

unknown
Transcript: ENSMUST00000146482
AA Change: D21G

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207651

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	C	8: 43,569,904	L183*	probably null	Het
Alox12e	G	T	11: 70,316,229	Q584K	probably benign	Het
Atp1a4	A	G	1: 172,246,832	S285P	probably damaging	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Col25a1	A	G	3: 130,595,663	T632A	probably benign	Het
Coro6	T	C	11: 77,467,796	F227S	probably damaging	Het
Diras2	C	T	13: 52,507,750	V174M	probably benign	Het
Dopey1	A	G	9: 86,507,730	D569G	probably benign	Het
Dync1li2	A	G	8: 104,440,472		probably null	Het
Dysf	T	C	6: 84,087,818	V508A	probably damaging	Het
Edem1	T	C	6: 108,843,100		probably null	Het
Espl1	A	G	15: 102,317,130	R1539G	possibly damaging	Het
Fat4	A	G	3: 38,887,215	S86G	probably benign	Het
Hpgd	A	T	8: 56,298,356	D73V	probably benign	Het
Ltb4r1	A	G	14: 55,768,082	N281D	probably damaging	Het
Map7	T	C	10: 20,276,202	S638P	unknown	Het
Mical1	G	A	10: 41,486,079	A934T	probably benign	Het
Micu3	C	A	8: 40,354,300		probably null	Het
Mmp24	T	A	2: 155,798,136	Y129N	probably damaging	Het
Mras	A	T	9: 99,411,546	Y14N	probably damaging	Het
Msmo1	A	T	8: 64,722,489	I169N	probably damaging	Het
Mtrr	G	T	13: 68,579,647	T60K	probably damaging	Het
Olfr1218	A	T	2: 89,054,886	L180*	probably null	Het
Olfr478	G	T	7: 108,032,153	Y63*	probably null	Het
Olfr849	T	A	9: 19,440,994	I27N	possibly damaging	Het
Pam	A	T	1: 97,840,365	C8*	probably null	Het
Phrf1	T	G	7: 141,259,921	S1169A	possibly damaging	Het
Pkd1l2	T	C	8: 117,065,830	T408A	probably damaging	Het
Plch1	G	T	3: 63,707,741	Q778K	probably damaging	Het
Ppp1r3a	A	G	6: 14,719,418	V499A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ryr3	C	A	2: 112,662,504	S3736I	possibly damaging	Het
Serpinb13	T	C	1: 106,982,185	F11L	possibly damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Smcp	A	G	3: 92,584,424	C39R	unknown	Het
Sox9	T	A	11: 112,783,859	L161Q	probably damaging	Het
Tanc2	T	C	11: 105,914,985		probably null	Het
Tlr3	C	T	8: 45,398,814	D349N	possibly damaging	Het
Tmem131l	G	T	3: 83,926,128	N809K	probably damaging	Het
Tyk2	T	C	9: 21,121,612	Y285C	probably damaging	Het
Usp15	T	A	10: 123,175,899	N98Y	probably damaging	Het

Other mutations in Eef2k

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01323:Eef2k	APN	7	120884815	unclassified	probably benign
IGL01481:Eef2k	APN	7	120895218	missense	probably benign	0.23
IGL01935:Eef2k	APN	7	120885831	missense	probably damaging	1.00
IGL03109:Eef2k	APN	7	120891726	missense	probably damaging	1.00
R0458:Eef2k	UTSW	7	120903290	missense	probably damaging	0.99
R1639:Eef2k	UTSW	7	120885828	missense	probably damaging	1.00
R1986:Eef2k	UTSW	7	120873346	missense	possibly damaging	0.92
R3419:Eef2k	UTSW	7	120885870	missense	probably damaging	0.99
R3610:Eef2k	UTSW	7	120889235	missense	probably benign
R3707:Eef2k	UTSW	7	120884712	missense	probably damaging	1.00
R3856:Eef2k	UTSW	7	120899371	nonsense	probably null
R4024:Eef2k	UTSW	7	120858598	missense	probably benign	0.01
R4535:Eef2k	UTSW	7	120858599	nonsense	probably null
R4885:Eef2k	UTSW	7	120891932	missense	probably benign
R5137:Eef2k	UTSW	7	120885422	missense	probably damaging	0.99
R5137:Eef2k	UTSW	7	120885423	missense	probably damaging	1.00
R5610:Eef2k	UTSW	7	120886782	missense	probably benign	0.00
R5633:Eef2k	UTSW	7	120873290	intron	probably benign
R7002:Eef2k	UTSW	7	120891932	missense	probably benign
R7166:Eef2k	UTSW	7	120884772	missense	probably damaging	1.00
R7254:Eef2k	UTSW	7	120889265	missense	probably benign	0.11
R7466:Eef2k	UTSW	7	120903484	splice site	probably null
R7486:Eef2k	UTSW	7	120858570	missense	probably benign
R7538:Eef2k	UTSW	7	120891992	missense	probably benign	0.29
R7593:Eef2k	UTSW	7	120889268	critical splice donor site	probably null
R7675:Eef2k	UTSW	7	120858504	missense	probably benign
R7815:Eef2k	UTSW	7	120858570	missense	probably benign
R7898:Eef2k	UTSW	7	120895218	missense	probably damaging	1.00
R8182:Eef2k	UTSW	7	120873403	missense	probably damaging	1.00
R8288:Eef2k	UTSW	7	120903381	missense	probably damaging	1.00
R8495:Eef2k	UTSW	7	120887880	missense	probably benign	0.00
R8807:Eef2k	UTSW	7	120891707	missense	possibly damaging	0.69
R8881:Eef2k	UTSW	7	120873325	missense	probably damaging	1.00
R8949:Eef2k	UTSW	7	120891988	missense	probably damaging	0.99
R9044:Eef2k	UTSW	7	120880361	missense	probably damaging	1.00
R9074:Eef2k	UTSW	7	120891901	missense	probably damaging	1.00
R9332:Eef2k	UTSW	7	120884695	missense	probably benign	0.00
R9445:Eef2k	UTSW	7	120858471	missense	probably benign
R9605:Eef2k	UTSW	7	120891947	missense	probably damaging	1.00
R9777:Eef2k	UTSW	7	120900230	critical splice acceptor site	probably benign
Z1177:Eef2k	UTSW	7	120858453	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AACTAGCCGCAGACTTTGGG -3'
(R):5'- TGGCTGAGTCTCTGCACTTC -3'

Sequencing Primer
(F):5'- TGAGCAGTTGCCCAGATCTTGAC -3'
(R):5'- GAGTCTCTGCACTTCACCTTC -3'

Posted On

2016-10-05