Incidental Mutation 'R5501:Eef2k'
ID 430609
Institutional Source Beutler Lab
Gene Symbol Eef2k
Ensembl Gene ENSMUSG00000035064
Gene Name eukaryotic elongation factor-2 kinase
Synonyms eEF-2K
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R5501 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 120842831-120907450 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120889248 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 452 (D452G)
Ref Sequence ENSEMBL: ENSMUSP00000102098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047875] [ENSMUST00000106487] [ENSMUST00000106488] [ENSMUST00000106489] [ENSMUST00000146482]
AlphaFold O08796
Predicted Effect probably benign
Transcript: ENSMUST00000047875
AA Change: D452G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000046595
Gene: ENSMUSG00000035064
AA Change: D452G

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 525 562 7.2e-5 PFAM
Pfam:Sel1 564 608 2.9e-3 PFAM
Pfam:Sel1 609 645 1.3e-1 PFAM
Pfam:Sel1 665 699 1.2e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106487
SMART Domains Protein: ENSMUSP00000102096
Gene: ENSMUSG00000035064

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 1e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
Pfam:Sel1 432 472 1.8e-3 PFAM
Pfam:Sel1 474 518 7.2e-3 PFAM
Pfam:Sel1 519 555 8e-2 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106488
AA Change: D452G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102097
Gene: ENSMUSG00000035064
AA Change: D452G

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106489
AA Change: D452G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102098
Gene: ENSMUSG00000035064
AA Change: D452G

DomainStartEndE-ValueType
Blast:Alpha_kinase 5 81 2e-12 BLAST
Alpha_kinase 120 317 7.75e-109 SMART
low complexity region 358 376 N/A INTRINSIC
Pfam:Sel1 522 562 1.1e-3 PFAM
Pfam:Sel1 564 608 3.9e-3 PFAM
Pfam:Sel1 609 645 4.8e-2 PFAM
Pfam:Sel1 664 699 4.6e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128813
Predicted Effect unknown
Transcript: ENSMUST00000146482
AA Change: D21G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207651
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein kinase in the calmodulin-mediated signaling pathway that links activation of cell surface receptors to cell division. This kinase is involved in the regulation of protein synthesis. It phosphorylates eukaryotic elongation factor 2 (EEF2) and thus inhibits the EEF2 function. The activity of this kinase is increased in many cancers and may be a valid target for anti-cancer treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired regulation of ovarian follicular degeneration and apoptosis, prolonged estrus, and increased ovarian follicle numbers in aged females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Eef2k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Eef2k APN 7 120884815 unclassified probably benign
IGL01481:Eef2k APN 7 120895218 missense probably benign 0.23
IGL01935:Eef2k APN 7 120885831 missense probably damaging 1.00
IGL03109:Eef2k APN 7 120891726 missense probably damaging 1.00
R0458:Eef2k UTSW 7 120903290 missense probably damaging 0.99
R1639:Eef2k UTSW 7 120885828 missense probably damaging 1.00
R1986:Eef2k UTSW 7 120873346 missense possibly damaging 0.92
R3419:Eef2k UTSW 7 120885870 missense probably damaging 0.99
R3610:Eef2k UTSW 7 120889235 missense probably benign
R3707:Eef2k UTSW 7 120884712 missense probably damaging 1.00
R3856:Eef2k UTSW 7 120899371 nonsense probably null
R4024:Eef2k UTSW 7 120858598 missense probably benign 0.01
R4535:Eef2k UTSW 7 120858599 nonsense probably null
R4885:Eef2k UTSW 7 120891932 missense probably benign
R5137:Eef2k UTSW 7 120885422 missense probably damaging 0.99
R5137:Eef2k UTSW 7 120885423 missense probably damaging 1.00
R5610:Eef2k UTSW 7 120886782 missense probably benign 0.00
R5633:Eef2k UTSW 7 120873290 intron probably benign
R7002:Eef2k UTSW 7 120891932 missense probably benign
R7166:Eef2k UTSW 7 120884772 missense probably damaging 1.00
R7254:Eef2k UTSW 7 120889265 missense probably benign 0.11
R7466:Eef2k UTSW 7 120903484 splice site probably null
R7486:Eef2k UTSW 7 120858570 missense probably benign
R7538:Eef2k UTSW 7 120891992 missense probably benign 0.29
R7593:Eef2k UTSW 7 120889268 critical splice donor site probably null
R7675:Eef2k UTSW 7 120858504 missense probably benign
R7815:Eef2k UTSW 7 120858570 missense probably benign
R7898:Eef2k UTSW 7 120895218 missense probably damaging 1.00
R8182:Eef2k UTSW 7 120873403 missense probably damaging 1.00
R8288:Eef2k UTSW 7 120903381 missense probably damaging 1.00
R8495:Eef2k UTSW 7 120887880 missense probably benign 0.00
R8807:Eef2k UTSW 7 120891707 missense possibly damaging 0.69
R8881:Eef2k UTSW 7 120873325 missense probably damaging 1.00
R8949:Eef2k UTSW 7 120891988 missense probably damaging 0.99
R9044:Eef2k UTSW 7 120880361 missense probably damaging 1.00
R9074:Eef2k UTSW 7 120891901 missense probably damaging 1.00
R9332:Eef2k UTSW 7 120884695 missense probably benign 0.00
R9445:Eef2k UTSW 7 120858471 missense probably benign
R9605:Eef2k UTSW 7 120891947 missense probably damaging 1.00
R9777:Eef2k UTSW 7 120900230 critical splice acceptor site probably benign
Z1177:Eef2k UTSW 7 120858453 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AACTAGCCGCAGACTTTGGG -3'
(R):5'- TGGCTGAGTCTCTGCACTTC -3'

Sequencing Primer
(F):5'- TGAGCAGTTGCCCAGATCTTGAC -3'
(R):5'- GAGTCTCTGCACTTCACCTTC -3'
Posted On 2016-10-05