Incidental Mutation 'R5501:Usp15'
ID430624
Institutional Source Beutler Lab
Gene Symbol Usp15
Ensembl Gene ENSMUSG00000020124
Gene Nameubiquitin specific peptidase 15
SynonymsGcap18, 4921514G19Rik, E430033I05Rik
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5501 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location123105006-123196995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123175899 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 98 (N98Y)
Ref Sequence ENSEMBL: ENSMUSP00000151244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020334] [ENSMUST00000220377]
Predicted Effect probably damaging
Transcript: ENSMUST00000020334
AA Change: N98Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020334
Gene: ENSMUSG00000020124
AA Change: N98Y

DomainStartEndE-ValueType
DUSP 23 121 1.5e-46 SMART
Pfam:Ubiquitin_3 135 222 3.7e-38 PFAM
low complexity region 242 262 N/A INTRINSIC
Pfam:UCH 288 930 6.8e-86 PFAM
Pfam:UCH_1 289 506 1.1e-5 PFAM
Pfam:USP7_C2 460 608 2e-7 PFAM
Pfam:UCH_1 756 912 1.3e-11 PFAM
low complexity region 959 976 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219010
Predicted Effect probably benign
Transcript: ENSMUST00000219619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220284
Predicted Effect probably damaging
Transcript: ENSMUST00000220377
AA Change: N98Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the large ubiquitin specific protease (Usp) family of proteins. These proteins are known to cleave ubiquitin, and contain a conserved cysteine residue (Cys box) and two conserved histidine residues (His box) that are thought to form part of the active site of the protease. This protein has been shown to cleave both the ubiquitin-proline and the ubiquitin-methionine bonds in vitro. This protein is thought to regulate many cellular processes through its deubiquitination activity, including the transforming growth factor beta (TGF-beta) pathway. Cardiac-specific overexpression of the human ortholog of this gene in mice causes enlargement of the heart that is more pronounced in the atrium than in the ventricle. This gene has two pseudogenes on chromosome 14. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms.[provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a knock-out allele or ENU induced allele exhibit resistance to pathological neuroinflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Other mutations in Usp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Usp15 APN 10 123113596 missense probably benign 0.00
IGL02148:Usp15 APN 10 123127837 missense probably damaging 1.00
IGL02737:Usp15 APN 10 123131032 missense probably damaging 1.00
IGL03054:Usp15 APN 10 123125931 splice site probably benign
IGL03163:Usp15 APN 10 123171144 missense probably damaging 0.96
R1755:Usp15 UTSW 10 123133044 missense probably damaging 0.98
R1981:Usp15 UTSW 10 123125041 splice site probably benign
R2049:Usp15 UTSW 10 123119137 missense probably damaging 1.00
R3037:Usp15 UTSW 10 123163617 missense probably damaging 1.00
R3698:Usp15 UTSW 10 123181738 missense probably damaging 1.00
R3828:Usp15 UTSW 10 123196870 missense possibly damaging 0.95
R3845:Usp15 UTSW 10 123119135 missense probably damaging 1.00
R4838:Usp15 UTSW 10 123127757 missense probably damaging 0.99
R4954:Usp15 UTSW 10 123131398 missense probably damaging 1.00
R5204:Usp15 UTSW 10 123113640 missense probably benign 0.06
R5274:Usp15 UTSW 10 123168351 missense probably damaging 1.00
R5387:Usp15 UTSW 10 123131286 missense probably damaging 0.96
R5474:Usp15 UTSW 10 123128045 missense probably damaging 1.00
R5665:Usp15 UTSW 10 123130987 nonsense probably null
R5846:Usp15 UTSW 10 123181742 missense probably damaging 1.00
R5850:Usp15 UTSW 10 123124512 critical splice donor site probably null
R6163:Usp15 UTSW 10 123168305 missense probably damaging 1.00
R6735:Usp15 UTSW 10 123168367 missense possibly damaging 0.86
R6828:Usp15 UTSW 10 123127989 missense probably damaging 1.00
R7170:Usp15 UTSW 10 123171195 missense probably damaging 1.00
R7197:Usp15 UTSW 10 123131005 missense possibly damaging 0.92
R7351:Usp15 UTSW 10 123132999 missense probably damaging 1.00
R7368:Usp15 UTSW 10 123196893 missense possibly damaging 0.86
R7447:Usp15 UTSW 10 123175881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGAAAATGCAGGTGAGTTC -3'
(R):5'- CAAGTCTCAGTATTTATGTCGTGTGC -3'

Sequencing Primer
(F):5'- GGTCAGCTGTTATAAGAATCCAGTG -3'
(R):5'- ATGTCGTGTGCAGCCATG -3'
Posted On2016-10-05