Incidental Mutation 'R5501:Sox9'
ID430629
Institutional Source Beutler Lab
Gene Symbol Sox9
Ensembl Gene ENSMUSG00000000567
Gene NameSRY (sex determining region Y)-box 9
Synonyms2010306G03Rik
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5501 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location112782224-112787760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112783859 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 161 (L161Q)
Ref Sequence ENSEMBL: ENSMUSP00000000579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000579]
Predicted Effect probably damaging
Transcript: ENSMUST00000000579
AA Change: L161Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000579
Gene: ENSMUSG00000000567
AA Change: L161Q

DomainStartEndE-ValueType
Pfam:Sox_N 22 94 9.6e-29 PFAM
HMG 104 174 2.34e-27 SMART
low complexity region 186 196 N/A INTRINSIC
low complexity region 234 241 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137081
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene recognizes the sequence CCTTGAG along with other members of the HMG-box class DNA-binding proteins. It acts during chondrocyte differentiation and, with steroidogenic factor 1, regulates transcription of the anti-Muellerian hormone (AMH) gene. Deficiencies lead to the skeletal malformation syndrome campomelic dysplasia, frequently with sex reversal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null mutant heterozygotes and conditional knockout mutants display perinatal lethality with cleft palate, hypoplasia and distortion of numerous cartilage-derived skeletal structures, and premature mineralization in many bones. Specific conditional knockout mutations are sex-reversed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Olfr849 T A 9: 19,440,994 I27N possibly damaging Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Sox9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Sox9 APN 11 112784674 missense probably benign 0.00
IGL02257:Sox9 APN 11 112784985 missense possibly damaging 0.84
IGL02935:Sox9 APN 11 112785349 missense probably damaging 0.99
R0350:Sox9 UTSW 11 112784876 missense probably damaging 0.99
R0634:Sox9 UTSW 11 112784942 missense probably damaging 0.98
R4273:Sox9 UTSW 11 112785154 missense possibly damaging 0.60
R4692:Sox9 UTSW 11 112782977 missense probably benign 0.01
R5328:Sox9 UTSW 11 112782658 missense probably benign 0.39
R5905:Sox9 UTSW 11 112783820 missense probably damaging 1.00
R6707:Sox9 UTSW 11 112782872 missense probably damaging 0.99
R6834:Sox9 UTSW 11 112784000 missense probably benign 0.01
R7897:Sox9 UTSW 11 112784809 missense probably benign 0.22
Z1176:Sox9 UTSW 11 112785122 missense possibly damaging 0.51
Z1177:Sox9 UTSW 11 112784803 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GGGTTTCCAAAATAGGAGGCC -3'
(R):5'- CTTAAGAGTGTGCCAGGAGGAC -3'

Sequencing Primer
(F):5'- TCAGGTCGACTCTGAGCAC -3'
(R):5'- TTGCTCACCAGAGTGCTCG -3'
Posted On2016-10-05