Mutagenetix > Incidental Mutation

Incidental Mutation 'R5501:Espl1'

430634

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

043062-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 102317130 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1539 (R1539G)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064924
AA Change: R1539G

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: R1539G

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000229050
AA Change: R1539G

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230116

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230617

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam26a	A	C	8: 43,569,904	L183*	probably null	Het
Alox12e	G	T	11: 70,316,229	Q584K	probably benign	Het
Atp1a4	A	G	1: 172,246,832	S285P	probably damaging	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Col25a1	A	G	3: 130,595,663	T632A	probably benign	Het
Coro6	T	C	11: 77,467,796	F227S	probably damaging	Het
Diras2	C	T	13: 52,507,750	V174M	probably benign	Het
Dopey1	A	G	9: 86,507,730	D569G	probably benign	Het
Dync1li2	A	G	8: 104,440,472		probably null	Het
Dysf	T	C	6: 84,087,818	V508A	probably damaging	Het
Edem1	T	C	6: 108,843,100		probably null	Het
Eef2k	A	G	7: 120,889,248	D452G	probably benign	Het
Fat4	A	G	3: 38,887,215	S86G	probably benign	Het
Hpgd	A	T	8: 56,298,356	D73V	probably benign	Het
Ltb4r1	A	G	14: 55,768,082	N281D	probably damaging	Het
Map7	T	C	10: 20,276,202	S638P	unknown	Het
Mical1	G	A	10: 41,486,079	A934T	probably benign	Het
Micu3	C	A	8: 40,354,300		probably null	Het
Mmp24	T	A	2: 155,798,136	Y129N	probably damaging	Het
Mras	A	T	9: 99,411,546	Y14N	probably damaging	Het
Msmo1	A	T	8: 64,722,489	I169N	probably damaging	Het
Mtrr	G	T	13: 68,579,647	T60K	probably damaging	Het
Olfr1218	A	T	2: 89,054,886	L180*	probably null	Het
Olfr478	G	T	7: 108,032,153	Y63*	probably null	Het
Olfr849	T	A	9: 19,440,994	I27N	possibly damaging	Het
Pam	A	T	1: 97,840,365	C8*	probably null	Het
Phrf1	T	G	7: 141,259,921	S1169A	possibly damaging	Het
Pkd1l2	T	C	8: 117,065,830	T408A	probably damaging	Het
Plch1	G	T	3: 63,707,741	Q778K	probably damaging	Het
Ppp1r3a	A	G	6: 14,719,418	V499A	probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ryr3	C	A	2: 112,662,504	S3736I	possibly damaging	Het
Serpinb13	T	C	1: 106,982,185	F11L	possibly damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Smcp	A	G	3: 92,584,424	C39R	unknown	Het
Sox9	T	A	11: 112,783,859	L161Q	probably damaging	Het
Tanc2	T	C	11: 105,914,985		probably null	Het
Tlr3	C	T	8: 45,398,814	D349N	possibly damaging	Het
Tmem131l	G	T	3: 83,926,128	N809K	probably damaging	Het
Tyk2	T	C	9: 21,121,612	Y285C	probably damaging	Het
Usp15	T	A	10: 123,175,899	N98Y	probably damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGTAGGACTTCAAGGGC -3'
(R):5'- GTCCTTTAAAAGTGTGCCTCC -3'

Sequencing Primer
(F):5'- GCAGAAGGCACGTGTTCTG -3'
(R):5'- TAAAAGTGTGCCTCCTGAAAAAG -3'

Posted On

2016-10-05