Incidental Mutation 'R5502:Myo3a'
ID 430640
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Name myosin IIIA
Synonyms 9030416P08Rik
MMRRC Submission 043063-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5502 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 22227503-22618252 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22558369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 52 (I52T)
Ref Sequence ENSEMBL: ENSMUSP00000116185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: I990T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: I990T

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138863
AA Change: I52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: I52T

DomainStartEndE-ValueType
Pfam:Myosin_head 1 110 1.7e-28 PFAM
IQ 123 145 2.88e1 SMART
IQ 150 172 9.48e-3 SMART
low complexity region 215 231 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
Meta Mutation Damage Score 0.8884 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Mycbp2 C T 14: 103,173,814 G284R probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr351 T C 2: 36,860,270 Y26C probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Sclt1 C T 3: 41,657,275 E521K probably benign Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Usp39 T A 6: 72,328,687 Q371L probably benign Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
lose UTSW 2 22558320 nonsense probably null
snooze UTSW 2 22282634 missense probably damaging 0.99
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
R7447:Myo3a UTSW 2 22544426 missense probably benign 0.27
R7456:Myo3a UTSW 2 22407444 missense probably benign 0.08
R7528:Myo3a UTSW 2 22266114 nonsense probably null
R7731:Myo3a UTSW 2 22282589 missense probably damaging 1.00
R7768:Myo3a UTSW 2 22241143 missense probably damaging 0.99
R8054:Myo3a UTSW 2 22574317 missense probably benign 0.00
R8140:Myo3a UTSW 2 22407346 missense probably damaging 1.00
R8143:Myo3a UTSW 2 22282665 critical splice donor site probably null
R8346:Myo3a UTSW 2 22558422 critical splice donor site probably null
R8421:Myo3a UTSW 2 22362124 missense probably benign 0.07
R8495:Myo3a UTSW 2 22396273 missense probably damaging 0.96
R8551:Myo3a UTSW 2 22332466 missense probably benign 0.00
R8708:Myo3a UTSW 2 22291796 splice site probably benign
R8757:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8759:Myo3a UTSW 2 22558307 missense possibly damaging 0.49
R8779:Myo3a UTSW 2 22245593 nonsense probably null
R8828:Myo3a UTSW 2 22241053 missense probably benign 0.01
R8910:Myo3a UTSW 2 22574268 missense probably benign 0.01
R8916:Myo3a UTSW 2 22567692 missense probably damaging 1.00
R8926:Myo3a UTSW 2 22396263 missense possibly damaging 0.95
R9028:Myo3a UTSW 2 22600087 missense possibly damaging 0.79
R9046:Myo3a UTSW 2 22558355 missense probably damaging 0.99
R9120:Myo3a UTSW 2 22544426 missense probably benign 0.27
R9153:Myo3a UTSW 2 22399933 missense probably benign 0.02
R9191:Myo3a UTSW 2 22579829 missense probably benign 0.24
R9258:Myo3a UTSW 2 22577533 missense possibly damaging 0.60
R9436:Myo3a UTSW 2 22407424 nonsense probably null
Z1177:Myo3a UTSW 2 22618140 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TACTGTGACTAACCACTTGTAACGTTG -3'
(R):5'- TGTCTCACCACAGAGGCATC -3'

Sequencing Primer
(F):5'- TGTCCGTTGCATCAAACC -3'
(R):5'- GAGGCATCCCAGAGCACAG -3'
Posted On 2016-10-05