Incidental Mutation 'R5502:Sstr4'
ID430645
Institutional Source Beutler Lab
Gene Symbol Sstr4
Ensembl Gene ENSMUSG00000037014
Gene Namesomatostatin receptor 4
SynonymsSmstr4, sst4
MMRRC Submission 043063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5502 (G1)
Quality Score217
Status Validated
Chromosome2
Chromosomal Location148395344-148396767 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CGAGGAGGAGGAGGA to CGAGGAGGAGGAGGAGGA at 148395551 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109962]
Predicted Effect probably benign
Transcript: ENSMUST00000109962
SMART Domains Protein: ENSMUSP00000105588
Gene: ENSMUSG00000037014

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 55 323 4.7e-16 PFAM
Pfam:7tm_1 61 308 2.2e-61 PFAM
Pfam:7TM_GPCR_Srv 117 325 1.8e-10 PFAM
Pfam:7TM_GPCR_Srw 203 326 8.1e-9 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygote null mice have increased susceptibility to inflammation, delayed type hypersensitivity, hyperalgesia and airway hypersensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Mycbp2 C T 14: 103,173,814 G284R probably damaging Het
Myo3a T C 2: 22,558,369 I52T probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr351 T C 2: 36,860,270 Y26C probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Sclt1 C T 3: 41,657,275 E521K probably benign Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Usp39 T A 6: 72,328,687 Q371L probably benign Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Sstr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Sstr4 APN 2 148395552 missense probably benign 0.00
IGL01536:Sstr4 APN 2 148395880 missense probably damaging 1.00
IGL02210:Sstr4 APN 2 148396309 missense probably damaging 1.00
IGL02670:Sstr4 APN 2 148396533 nonsense probably null
R0396:Sstr4 UTSW 2 148396261 missense probably damaging 1.00
R1428:Sstr4 UTSW 2 148396359 missense probably benign 0.01
R1839:Sstr4 UTSW 2 148395533 missense probably benign 0.21
R2332:Sstr4 UTSW 2 148396410 missense probably damaging 1.00
R2943:Sstr4 UTSW 2 148396165 missense probably damaging 0.96
R3700:Sstr4 UTSW 2 148396353 missense possibly damaging 0.57
R5503:Sstr4 UTSW 2 148395551 small insertion probably benign
R5596:Sstr4 UTSW 2 148395732 missense possibly damaging 0.65
R5726:Sstr4 UTSW 2 148396083 missense probably damaging 1.00
R6985:Sstr4 UTSW 2 148396249 missense probably damaging 0.97
X0022:Sstr4 UTSW 2 148395532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGCTCTTCGGGCAAAGG -3'
(R):5'- AGCATGAAGAGCTCATCGG -3'

Sequencing Primer
(F):5'- TTCGGGCAAAGGCACCTG -3'
(R):5'- ATGAAGAGCTCATCGGCGACG -3'
Posted On2016-10-05