Incidental Mutation 'R5502:Sclt1'
ID430647
Institutional Source Beutler Lab
Gene Symbol Sclt1
Ensembl Gene ENSMUSG00000059834
Gene Namesodium channel and clathrin linker 1
Synonyms2610207F23Rik, 4931421F20Rik
MMRRC Submission 043063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R5502 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location41626720-41742514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41657275 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 521 (E521K)
Ref Sequence ENSEMBL: ENSMUSP00000026866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026866] [ENSMUST00000146125] [ENSMUST00000148769]
Predicted Effect probably benign
Transcript: ENSMUST00000026866
AA Change: E521K

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026866
Gene: ENSMUSG00000059834
AA Change: E521K

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
internal_repeat_1 166 179 6.29e-5 PROSPERO
coiled coil region 372 543 N/A INTRINSIC
internal_repeat_1 555 568 6.29e-5 PROSPERO
coiled coil region 571 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140373
Predicted Effect probably benign
Transcript: ENSMUST00000146125
Predicted Effect probably benign
Transcript: ENSMUST00000148769
SMART Domains Protein: ENSMUSP00000123392
Gene: ENSMUSG00000059834

DomainStartEndE-ValueType
coiled coil region 59 105 N/A INTRINSIC
coiled coil region 178 333 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154773
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous knockout causes polycystic kidney disease, impaired postnatal weight gain and premature death (before 1 month of age). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Mycbp2 C T 14: 103,173,814 G284R probably damaging Het
Myo3a T C 2: 22,558,369 I52T probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr351 T C 2: 36,860,270 Y26C probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Usp39 T A 6: 72,328,687 Q371L probably benign Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Sclt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Sclt1 APN 3 41741991 unclassified probably benign
IGL01106:Sclt1 APN 3 41675319 splice site probably benign
IGL01368:Sclt1 APN 3 41711175 missense probably damaging 0.96
IGL02001:Sclt1 APN 3 41681721 missense possibly damaging 0.63
IGL02897:Sclt1 APN 3 41675387 missense probably benign 0.01
IGL03066:Sclt1 APN 3 41717843 missense probably benign 0.00
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0038:Sclt1 UTSW 3 41629508 splice site probably benign
R0172:Sclt1 UTSW 3 41717787 missense possibly damaging 0.84
R0359:Sclt1 UTSW 3 41661570 critical splice donor site probably null
R1281:Sclt1 UTSW 3 41647620 missense probably benign 0.01
R1831:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1832:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R1833:Sclt1 UTSW 3 41727111 missense probably damaging 0.99
R2027:Sclt1 UTSW 3 41730888 missense probably benign 0.00
R4578:Sclt1 UTSW 3 41671465 nonsense probably null
R5558:Sclt1 UTSW 3 41661590 missense probably benign 0.14
R5601:Sclt1 UTSW 3 41730919 missense probably benign
R5710:Sclt1 UTSW 3 41663963 nonsense probably null
R6041:Sclt1 UTSW 3 41627177 missense probably damaging 0.99
R6274:Sclt1 UTSW 3 41629516 critical splice donor site probably null
R6765:Sclt1 UTSW 3 41730902 missense unknown
R7171:Sclt1 UTSW 3 41717760 missense probably benign 0.00
R7489:Sclt1 UTSW 3 41629597 missense probably damaging 0.99
R8040:Sclt1 UTSW 3 41657376 missense probably damaging 1.00
R8158:Sclt1 UTSW 3 41671482 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TAGGTGTCTGTCTACTCATGAATG -3'
(R):5'- TTCAATCCTCAGCACCATGC -3'

Sequencing Primer
(F):5'- TCATGAATGGGTCTGCACAC -3'
(R):5'- AGTTTACATCGTAAAGTGTACACATC -3'
Posted On2016-10-05