Incidental Mutation 'R5502:Usp39'
ID430663
Institutional Source Beutler Lab
Gene Symbol Usp39
Ensembl Gene ENSMUSG00000056305
Gene Nameubiquitin specific peptidase 39
SynonymsSAD1, CGI-21, D6Wsu157e
MMRRC Submission 043063-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5502 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72318678-72345184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72328687 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 371 (Q371L)
Ref Sequence ENSEMBL: ENSMUSP00000064515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070345]
Predicted Effect probably benign
Transcript: ENSMUST00000070345
AA Change: Q371L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064515
Gene: ENSMUSG00000056305
AA Change: Q371L

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 48 73 N/A INTRINSIC
ZnF_C2H2 133 154 5.07e0 SMART
Pfam:UCH 223 551 3.9e-45 PFAM
Pfam:UCH_1 224 533 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154799
Meta Mutation Damage Score 0.0905 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ibtk A C 9: 85,720,863 S696R probably benign Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Mycbp2 C T 14: 103,173,814 G284R probably damaging Het
Myo3a T C 2: 22,558,369 I52T probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr351 T C 2: 36,860,270 Y26C probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Sclt1 C T 3: 41,657,275 E521K probably benign Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Usp39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Usp39 APN 6 72328624 missense probably damaging 0.99
IGL01065:Usp39 APN 6 72339975 missense probably damaging 1.00
IGL01669:Usp39 APN 6 72338493 missense probably damaging 0.99
IGL03089:Usp39 APN 6 72328639 missense probably damaging 1.00
IGL03397:Usp39 APN 6 72336313 missense possibly damaging 0.53
R0561:Usp39 UTSW 6 72336385 missense probably damaging 1.00
R3236:Usp39 UTSW 6 72338389 splice site probably benign
R3552:Usp39 UTSW 6 72337832 missense possibly damaging 0.63
R4010:Usp39 UTSW 6 72336485 missense probably benign 0.44
R4854:Usp39 UTSW 6 72325682 missense probably benign 0.29
R6868:Usp39 UTSW 6 72337751 missense possibly damaging 0.93
R6887:Usp39 UTSW 6 72333157 missense probably damaging 1.00
R7313:Usp39 UTSW 6 72336430 missense probably benign 0.00
R7429:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7430:Usp39 UTSW 6 72342917 missense probably damaging 1.00
R7431:Usp39 UTSW 6 72336268 missense possibly damaging 0.66
R7544:Usp39 UTSW 6 72342908 missense probably damaging 1.00
R7548:Usp39 UTSW 6 72345013 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTCCGTGATGCCGTTGAAC -3'
(R):5'- AAACTCTTGTCCTGCTTGACG -3'

Sequencing Primer
(F):5'- ATGCCGTTGAACTTGGCCAG -3'
(R):5'- TTCTAGTTTCATGACACACACAGGC -3'
Posted On2016-10-05