Incidental Mutation 'R5502:Ibtk'
ID430684
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Nameinhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms5430411K16Rik
MMRRC Submission 043063-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5502 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85687360-85749334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85720863 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 696 (S696R)
Ref Sequence ENSEMBL: ENSMUSP00000041145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
Predicted Effect probably benign
Transcript: ENSMUST00000039213
AA Change: S696R

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: S696R

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186322
Predicted Effect probably benign
Transcript: ENSMUST00000187521
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188768
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.0%
  • 20x: 90.2%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abcc8 A G 7: 46,108,838 I1268T probably benign Het
Accsl C T 2: 93,856,944 probably null Het
Ank3 A T 10: 69,920,461 I842F probably benign Het
Bbs9 T A 9: 22,504,074 L98Q probably damaging Het
BC017158 C T 7: 128,285,136 V225M probably damaging Het
BC024978 A G 7: 27,197,117 D35G possibly damaging Het
Bin2 A G 15: 100,645,405 V299A probably benign Het
Cabp4 G A 19: 4,131,229 probably benign Het
Ces2f A T 8: 104,952,523 H324L possibly damaging Het
Chd4 G A 6: 125,105,276 R576Q possibly damaging Het
Cndp1 A G 18: 84,632,013 V185A possibly damaging Het
Cntn3 A C 6: 102,265,334 V450G possibly damaging Het
Col5a2 C A 1: 45,380,126 G1265W probably damaging Het
Corin G A 5: 72,316,106 Q754* probably null Het
Cyp4a10 A G 4: 115,525,505 N291S probably benign Het
Dap3 T C 3: 88,925,326 Y353C probably damaging Het
Disp1 A G 1: 183,087,886 V990A probably damaging Het
Dock9 A T 14: 121,610,182 probably null Het
Dopey2 T A 16: 93,793,226 V179E probably benign Het
Eps15l1 A T 8: 72,378,992 probably null Het
Fyb2 A T 4: 104,945,324 Q141L probably damaging Het
Gemin4 A T 11: 76,213,401 L178* probably null Het
Gm15446 A T 5: 109,940,498 K25* probably null Het
Gm17067 A T 7: 42,708,419 C220S probably damaging Het
Gm4868 A G 5: 125,847,978 noncoding transcript Het
Golga4 GT GTT 9: 118,559,057 probably null Het
Gria2 T C 3: 80,706,945 N596S probably damaging Het
Hoxb4 A G 11: 96,320,231 D219G probably damaging Het
Htr1b T A 9: 81,631,801 Q251L possibly damaging Het
Ide C A 19: 37,330,456 K52N unknown Het
Incenp C A 19: 9,893,364 L300F unknown Het
Ino80 T C 2: 119,402,396 Y1147C probably damaging Het
Mme T A 3: 63,300,281 Y49* probably null Het
Mmp15 A T 8: 95,368,184 T229S possibly damaging Het
Mtmr4 A T 11: 87,614,078 N1133I probably damaging Het
Mycbp2 C T 14: 103,173,814 G284R probably damaging Het
Myo3a T C 2: 22,558,369 I52T probably damaging Het
Nat8f5 G T 6: 85,817,653 F108L probably damaging Het
Nbeal1 T A 1: 60,310,999 H2402Q probably damaging Het
Nexn T A 3: 152,238,304 E331D probably damaging Het
Nktr C T 9: 121,748,606 probably benign Het
Oaz3 T C 3: 94,435,085 D88G probably damaging Het
Olfr351 T C 2: 36,860,270 Y26C probably damaging Het
Olfr723 A G 14: 49,929,536 Y3H probably benign Het
Pcdhb9 A T 18: 37,401,603 T217S possibly damaging Het
Pcdhga2 A T 18: 37,670,552 D483V possibly damaging Het
Pde5a G T 3: 122,803,032 G456V probably damaging Het
Qser1 T C 2: 104,786,574 T1298A probably benign Het
Rapgef5 T C 12: 117,721,329 V303A probably damaging Het
Rbbp6 T G 7: 122,988,724 M267R probably damaging Het
Rfx8 C A 1: 39,682,953 V291F probably damaging Het
Rnf121 T C 7: 102,023,348 K276R probably null Het
Rtca G T 3: 116,489,282 Y352* probably null Het
Sacs T C 14: 61,206,100 V1865A probably damaging Het
Sclt1 C T 3: 41,657,275 E521K probably benign Het
Setd1a T C 7: 127,797,248 probably null Het
Slc37a4 G T 9: 44,402,097 V337L probably benign Het
Slc5a9 G T 4: 111,893,169 S79* probably null Het
Snrpd2 T C 7: 19,151,322 V36A probably benign Het
Spata31d1b A T 13: 59,716,672 N545Y probably damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
St7 G A 6: 17,834,674 V98I possibly damaging Het
Strip2 A T 6: 29,927,624 I223F probably benign Het
Syn2 A C 6: 115,278,352 N542H possibly damaging Het
Tbc1d2b T C 9: 90,227,443 T327A probably benign Het
Timm44 A T 8: 4,269,992 F59I possibly damaging Het
Tmem41b A T 7: 109,982,763 C44* probably null Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Tusc3 A T 8: 39,130,793 K188* probably null Het
Usp39 T A 6: 72,328,687 Q371L probably benign Het
Vmn2r13 G T 5: 109,173,714 N372K probably damaging Het
Zfp961 T A 8: 71,968,059 Y139N probably damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85717545 splice site probably null
IGL00852:Ibtk APN 9 85713601 missense probably benign 0.01
IGL00907:Ibtk APN 9 85690331 missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85732622 splice site probably benign
IGL02125:Ibtk APN 9 85735070 missense probably damaging 1.00
IGL02214:Ibtk APN 9 85714179 splice site probably benign
IGL02223:Ibtk APN 9 85710366 splice site probably benign
IGL02638:Ibtk APN 9 85719893 missense probably damaging 1.00
IGL02741:Ibtk APN 9 85726612 missense probably damaging 1.00
IGL03299:Ibtk APN 9 85721136 missense probably benign 0.27
IGL03493:Ibtk APN 9 85718919 missense probably benign 0.44
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0558:Ibtk UTSW 9 85737538 missense probably damaging 0.99
R0569:Ibtk UTSW 9 85708181 splice site probably benign
R0932:Ibtk UTSW 9 85735046 missense probably damaging 1.00
R0973:Ibtk UTSW 9 85743577 missense probably damaging 1.00
R1237:Ibtk UTSW 9 85720748 missense probably benign 0.00
R1245:Ibtk UTSW 9 85720742 critical splice donor site probably null
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1921:Ibtk UTSW 9 85703082 missense probably benign
R2090:Ibtk UTSW 9 85720993 missense probably benign 0.01
R2109:Ibtk UTSW 9 85706550 missense probably benign
R2277:Ibtk UTSW 9 85703151 missense probably benign
R2437:Ibtk UTSW 9 85708125 missense probably benign 0.27
R2446:Ibtk UTSW 9 85703073 missense probably benign 0.22
R3107:Ibtk UTSW 9 85710414 missense probably damaging 1.00
R3876:Ibtk UTSW 9 85718426 missense probably benign 0.06
R4160:Ibtk UTSW 9 85703090 missense probably benign 0.01
R4273:Ibtk UTSW 9 85726731 missense probably damaging 1.00
R4321:Ibtk UTSW 9 85735072 missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85728554 missense probably benign 0.04
R4947:Ibtk UTSW 9 85710412 missense probably benign 0.00
R5228:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5268:Ibtk UTSW 9 85743690 missense probably benign 0.00
R5327:Ibtk UTSW 9 85737466 critical splice donor site probably null
R5344:Ibtk UTSW 9 85735004 missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5756:Ibtk UTSW 9 85731254 missense possibly damaging 0.51
R7144:Ibtk UTSW 9 85743691 missense probably benign 0.03
R7196:Ibtk UTSW 9 85743656 missense probably damaging 1.00
R7490:Ibtk UTSW 9 85718934 critical splice acceptor site probably null
R7571:Ibtk UTSW 9 85722300 missense probably benign
R7757:Ibtk UTSW 9 85697237 missense possibly damaging 0.87
R8007:Ibtk UTSW 9 85690717
R8065:Ibtk UTSW 9 85720863 missense probably benign 0.13
X0021:Ibtk UTSW 9 85697174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TACTACTACCCCAGAGGCAGAG -3'
(R):5'- CCTGTGACTTGTTAACTCATGGC -3'

Sequencing Primer
(F):5'- CAATGCTTCAAGGGAGGGCTG -3'
(R):5'- TGGCTTCAAACCAAGAATGATCGTG -3'
Posted On2016-10-05