Incidental Mutation 'R5503:Ptprn'
ID 430707
Institutional Source Beutler Lab
Gene Symbol Ptprn
Ensembl Gene ENSMUSG00000026204
Gene Name protein tyrosine phosphatase receptor type N
Synonyms IA-2
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.624) question?
Stock # R5503 (G1)
Quality Score 93
Status Validated
Chromosome 1
Chromosomal Location 75223671-75241146 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 75228519 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 853 (V853M)
Ref Sequence ENSEMBL: ENSMUSP00000027404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027404
AA Change: V853M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204
AA Change: V853M

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191154
Meta Mutation Damage Score 0.8195 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Ptprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Ptprn APN 1 75,228,914 (GRCm39) missense probably damaging 0.99
IGL01900:Ptprn APN 1 75,228,892 (GRCm39) splice site probably benign
IGL02189:Ptprn APN 1 75,235,139 (GRCm39) missense possibly damaging 0.73
IGL02282:Ptprn APN 1 75,229,800 (GRCm39) missense probably damaging 1.00
IGL02452:Ptprn APN 1 75,234,813 (GRCm39) missense probably benign 0.34
IGL02865:Ptprn APN 1 75,239,007 (GRCm39) missense probably damaging 1.00
IGL02926:Ptprn APN 1 75,224,517 (GRCm39) missense possibly damaging 0.95
IGL03062:Ptprn APN 1 75,224,517 (GRCm39) missense possibly damaging 0.95
ascorbic UTSW 1 75,224,537 (GRCm39) missense probably benign 0.16
Delusion UTSW 1 75,224,810 (GRCm39) missense probably damaging 1.00
H8562:Ptprn UTSW 1 75,231,264 (GRCm39) missense possibly damaging 0.66
R0051:Ptprn UTSW 1 75,228,898 (GRCm39) critical splice donor site probably null
R0107:Ptprn UTSW 1 75,232,356 (GRCm39) missense probably damaging 0.99
R0801:Ptprn UTSW 1 75,228,909 (GRCm39) missense probably damaging 1.00
R0865:Ptprn UTSW 1 75,224,782 (GRCm39) splice site probably null
R1120:Ptprn UTSW 1 75,234,825 (GRCm39) missense probably benign 0.00
R1534:Ptprn UTSW 1 75,234,587 (GRCm39) critical splice donor site probably null
R1740:Ptprn UTSW 1 75,238,694 (GRCm39) missense probably damaging 1.00
R1857:Ptprn UTSW 1 75,224,549 (GRCm39) missense possibly damaging 0.64
R1927:Ptprn UTSW 1 75,230,766 (GRCm39) missense probably benign 0.00
R1974:Ptprn UTSW 1 75,231,464 (GRCm39) splice site probably null
R2071:Ptprn UTSW 1 75,231,788 (GRCm39) missense probably damaging 1.00
R2223:Ptprn UTSW 1 75,234,581 (GRCm39) unclassified probably benign
R3714:Ptprn UTSW 1 75,229,411 (GRCm39) splice site probably null
R4617:Ptprn UTSW 1 75,228,931 (GRCm39) missense possibly damaging 0.74
R4832:Ptprn UTSW 1 75,234,909 (GRCm39) missense probably benign 0.37
R5926:Ptprn UTSW 1 75,231,242 (GRCm39) missense probably damaging 1.00
R6217:Ptprn UTSW 1 75,224,810 (GRCm39) missense probably damaging 1.00
R6419:Ptprn UTSW 1 75,240,681 (GRCm39) missense probably benign 0.10
R6793:Ptprn UTSW 1 75,234,786 (GRCm39) missense probably benign 0.38
R6964:Ptprn UTSW 1 75,237,293 (GRCm39) missense possibly damaging 0.83
R7071:Ptprn UTSW 1 75,237,263 (GRCm39) missense possibly damaging 0.82
R7680:Ptprn UTSW 1 75,224,537 (GRCm39) missense probably benign 0.16
R7777:Ptprn UTSW 1 75,228,946 (GRCm39) missense possibly damaging 0.54
R7883:Ptprn UTSW 1 75,239,007 (GRCm39) missense probably damaging 1.00
R8233:Ptprn UTSW 1 75,229,796 (GRCm39) missense probably damaging 1.00
R8243:Ptprn UTSW 1 75,229,179 (GRCm39) missense probably damaging 0.99
R8941:Ptprn UTSW 1 75,228,407 (GRCm39) missense probably damaging 1.00
R9076:Ptprn UTSW 1 75,229,018 (GRCm39) missense probably damaging 1.00
R9382:Ptprn UTSW 1 75,229,135 (GRCm39) missense probably benign 0.05
X0017:Ptprn UTSW 1 75,229,909 (GRCm39) missense probably benign 0.15
Z1088:Ptprn UTSW 1 75,237,264 (GRCm39) missense possibly damaging 0.70
Z1176:Ptprn UTSW 1 75,228,462 (GRCm39) missense probably damaging 0.99
Z1177:Ptprn UTSW 1 75,234,681 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACGGCCAAACTGTCAGTACTG -3'
(R):5'- GCCATGCGTATGTAAGACAGG -3'

Sequencing Primer
(F):5'- CCAAACTGTCAGTACTGGTTTG -3'
(R):5'- GCCTTTAACCTCCCGAAA -3'
Posted On 2016-10-05