Mutagenetix > Incidental Mutations

Incidental Mutation 'R5503:F13b'

430711

Institutional Source

Beutler Lab

Gene Symbol

F13b

Ensembl Gene

ENSMUSG00000026368

Gene Name

coagulation factor XIII, beta subunit

Synonyms

Cf-13b, Cf13b

MMRRC Submission

043064-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

139501702-139523752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 139522543 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 648 (T648A)

Ref Sequence

ENSEMBL: ENSMUSP00000027615 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027615]

AlphaFold

Q07968

Predicted Effect

probably benign
Transcript: ENSMUST00000027615
AA Change: T648A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000027615
Gene: ENSMUSG00000026368
AA Change: T648A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CCP	26	88	1.26e-7	SMART
CCP	92	147	2.11e-9	SMART
CCP	154	209	9.83e-10	SMART
CCP	214	268	7.62e-16	SMART
CCP	275	328	8.62e-15	SMART
CCP	337	390	4.62e-15	SMART
CCP	397	451	3.5e-15	SMART
Blast:CCP	455	516	1e-28	BLAST
CCP	525	579	2.44e-14	SMART
Blast:CCP	583	647	1e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141842

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: This gene encodes subunit B of the coagulation factor XIII that catalyzes the final step of the blood coagulation pathway. The encoded protein associates with subunit A to form a heterotetrameric protein that circulates in the plasma. During the blood coagulation process, thrombin-mediated proteolytic cleavage of the subunit A results in the dissociation of the encoded protein from the heterotetramer. Male mice lacking the encoded protein exhibit mild fibrosis together with hemosiderin deposits in the heart. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null mutation display increased bleeding time. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in F13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:F13b	APN	1	139510587	missense	probably benign	0.01
IGL00937:F13b	APN	1	139517360	splice site	probably benign
IGL01138:F13b	APN	1	139517212	missense	probably damaging	0.99
IGL01319:F13b	APN	1	139506793	missense	probably damaging	0.98
IGL01328:F13b	APN	1	139508082	splice site	probably benign
IGL01621:F13b	APN	1	139503851	missense	probably benign	0.00
IGL01843:F13b	APN	1	139516427	missense	probably damaging	1.00
IGL02153:F13b	APN	1	139516377	missense	probably damaging	1.00
IGL02192:F13b	APN	1	139517333	missense	probably damaging	1.00
IGL02555:F13b	APN	1	139517186	missense	probably damaging	1.00
IGL03036:F13b	APN	1	139508115	missense	possibly damaging	0.80
IGL03185:F13b	APN	1	139516386	missense	probably benign	0.03
IGL03303:F13b	APN	1	139513036	missense	possibly damaging	0.67
IGL03335:F13b	APN	1	139522386	missense	probably damaging	1.00
IGL03371:F13b	APN	1	139506936	missense	probably damaging	1.00
R0139:F13b	UTSW	1	139508203	missense	probably damaging	0.96
R0157:F13b	UTSW	1	139503847	missense	probably benign
R0381:F13b	UTSW	1	139510859	missense	probably damaging	0.98
R0492:F13b	UTSW	1	139522559	splice site	probably null
R0589:F13b	UTSW	1	139506933	missense	possibly damaging	0.94
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1462:F13b	UTSW	1	139507636	missense	probably damaging	1.00
R1515:F13b	UTSW	1	139510965	missense	probably damaging	1.00
R1869:F13b	UTSW	1	139510934	missense	probably benign	0.44
R2047:F13b	UTSW	1	139508223	missense	probably damaging	1.00
R2218:F13b	UTSW	1	139506844	missense	probably benign	0.42
R2878:F13b	UTSW	1	139501747	start codon destroyed	probably null
R3032:F13b	UTSW	1	139517333	missense	probably damaging	1.00
R4077:F13b	UTSW	1	139501770	missense	unknown
R4079:F13b	UTSW	1	139501770	missense	unknown
R4208:F13b	UTSW	1	139516341	missense	probably damaging	1.00
R4350:F13b	UTSW	1	139516298	missense	probably benign	0.00
R4674:F13b	UTSW	1	139501804	missense	unknown
R4675:F13b	UTSW	1	139501804	missense	unknown
R4972:F13b	UTSW	1	139510923	missense	probably damaging	1.00
R5212:F13b	UTSW	1	139512987	missense	probably benign
R5343:F13b	UTSW	1	139510544	missense	possibly damaging	0.61
R5984:F13b	UTSW	1	139508212	missense	probably damaging	1.00
R7012:F13b	UTSW	1	139516358	missense	probably benign
R7155:F13b	UTSW	1	139508157	missense	probably damaging	1.00
R7250:F13b	UTSW	1	139516489	critical splice donor site	probably null
R7478:F13b	UTSW	1	139507695	missense	probably benign	0.01
R7779:F13b	UTSW	1	139516386	missense	probably benign	0.03
R7960:F13b	UTSW	1	139503771	nonsense	probably null
R8007:F13b	UTSW	1	139506942	missense	probably benign	0.11
R8043:F13b	UTSW	1	139522448	missense	probably benign
R8281:F13b	UTSW	1	139510951	missense	probably benign	0.03
R9034:F13b	UTSW	1	139508223	missense	probably damaging	1.00
Z1088:F13b	UTSW	1	139508202	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- CCAGAGCCTTGCACATTATCATTTG -3'
(R):5'- GCAATTGGACTCCAGGAAACTC -3'

Sequencing Primer
(F):5'- TGCACATTATCATTTGTTGAAATGG -3'
(R):5'- CTCAAAAACTTCCAGTGTTTAGTTG -3'

Posted On

2016-10-05