Incidental Mutation 'R5503:Kntc1'
ID430728
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Namekinetochore associated 1
Synonyms
MMRRC Submission 043064-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R5503 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location123749716-123821593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123819876 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2173 (D2173E)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031366
AA Change: D2173E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: D2173E

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197002
Predicted Effect probably benign
Transcript: ENSMUST00000197265
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123790159 missense probably benign 0.05
IGL00514:Kntc1 APN 5 123791527 missense probably benign 0.00
IGL01103:Kntc1 APN 5 123764220 missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123762603 missense probably benign 0.01
IGL01357:Kntc1 APN 5 123757814 missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123758483 missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123781658 missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123765005 missense probably benign 0.02
IGL01595:Kntc1 APN 5 123803695 missense probably benign 0.30
IGL01725:Kntc1 APN 5 123764190 missense probably benign
IGL01916:Kntc1 APN 5 123801913 missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123811376 missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123778267 missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123765958 missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123809096 missense probably benign 0.12
IGL02145:Kntc1 APN 5 123762598 missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123819062 missense probably benign 0.03
IGL02611:Kntc1 APN 5 123812065 missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123755664 splice site probably benign
IGL02737:Kntc1 APN 5 123819120 missense probably benign 0.17
IGL02793:Kntc1 APN 5 123778277 splice site probably null
IGL02809:Kntc1 APN 5 123776582 missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123769873 missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123778277 splice site probably null
IGL02931:Kntc1 APN 5 123799811 missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123775821 missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123758480 missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0006:Kntc1 UTSW 5 123789138 missense probably benign 0.19
R0017:Kntc1 UTSW 5 123780981 missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123765057 splice site probably benign
R0324:Kntc1 UTSW 5 123778112 missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123803669 missense probably benign 0.00
R0608:Kntc1 UTSW 5 123786074 missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123769704 missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123790916 missense probably null
R0781:Kntc1 UTSW 5 123799902 splice site probably benign
R0787:Kntc1 UTSW 5 123796104 missense probably benign
R1250:Kntc1 UTSW 5 123784199 missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123810862 frame shift probably null
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1467:Kntc1 UTSW 5 123786984 missense probably benign 0.04
R1481:Kntc1 UTSW 5 123778275 missense probably benign 0.00
R1572:Kntc1 UTSW 5 123772113 missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123758477 missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123789099 missense probably benign 0.00
R1993:Kntc1 UTSW 5 123759099 critical splice donor site probably null
R1993:Kntc1 UTSW 5 123810811 critical splice acceptor site probably null
R2071:Kntc1 UTSW 5 123794277 splice site probably null
R2237:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123803670 missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123760348 missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123781192 missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123764149 missense probably benign 0.01
R2442:Kntc1 UTSW 5 123810859 missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123778347 nonsense probably null
R2943:Kntc1 UTSW 5 123797784 missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123802058 missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123762598 missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123776617 missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123767779 missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123794153 missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123765955 missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123812643 missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123811433 missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123765023 missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123816762 missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123790133 nonsense probably null
R4847:Kntc1 UTSW 5 123802274 missense probably benign 0.18
R4849:Kntc1 UTSW 5 123759065 missense probably benign 0.02
R4904:Kntc1 UTSW 5 123778333 missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123802246 missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123762586 missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123781055 critical splice donor site probably null
R5171:Kntc1 UTSW 5 123799844 missense probably benign 0.01
R5220:Kntc1 UTSW 5 123812097 missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123794172 missense probably benign 0.09
R5278:Kntc1 UTSW 5 123781014 missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123764191 missense probably benign 0.02
R5496:Kntc1 UTSW 5 123784182 missense probably benign 0.00
R5633:Kntc1 UTSW 5 123819057 missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123818475 missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123765007 missense probably benign 0.00
R5757:Kntc1 UTSW 5 123807309 critical splice donor site probably null
R5773:Kntc1 UTSW 5 123794157 missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123786195 missense probably benign 0.05
R6019:Kntc1 UTSW 5 123762516 missense probably benign 0.03
R6230:Kntc1 UTSW 5 123789009 splice site probably null
R6437:Kntc1 UTSW 5 123769691 missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123811310 missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123801825 missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123781726 missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123786973 missense probably benign 0.18
R7381:Kntc1 UTSW 5 123810908 missense probably benign 0.12
R7485:Kntc1 UTSW 5 123786956 missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123790938 missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123816755 missense probably benign 0.05
R7687:Kntc1 UTSW 5 123759089 missense probably benign 0.01
R7798:Kntc1 UTSW 5 123786294 missense probably benign
R7798:Kntc1 UTSW 5 123819117 missense possibly damaging 0.94
R7871:Kntc1 UTSW 5 123784227 missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123775787 missense probably damaging 1.00
R7947:Kntc1 UTSW 5 123781888 missense unknown
R7997:Kntc1 UTSW 5 123778054 missense probably damaging 0.96
R8231:Kntc1 UTSW 5 123782896 missense possibly damaging 0.47
R8257:Kntc1 UTSW 5 123758523 critical splice donor site probably null
R8345:Kntc1 UTSW 5 123786930 missense probably benign 0.37
R8354:Kntc1 UTSW 5 123778267 missense probably damaging 1.00
X0027:Kntc1 UTSW 5 123810929 missense probably benign 0.00
X0065:Kntc1 UTSW 5 123778037 nonsense probably null
X0067:Kntc1 UTSW 5 123778074 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGAGTGACAGTTTGAGCTAC -3'
(R):5'- GTGCACATAGTAGTTGATAACGACG -3'

Sequencing Primer
(F):5'- GCTACAGTTGATTCGTACACTAGACC -3'
(R):5'- CTTGGACCACATAGTGAGCTCATG -3'
Posted On2016-10-05