Incidental Mutation 'R5503:Kntc1'
ID 430728
Institutional Source Beutler Lab
Gene Symbol Kntc1
Ensembl Gene ENSMUSG00000029414
Gene Name kinetochore associated 1
Synonyms jgl
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 123887779-123959656 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 123957939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2173 (D2173E)
Ref Sequence ENSEMBL: ENSMUSP00000031366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031366]
AlphaFold Q8C3Y4
Predicted Effect possibly damaging
Transcript: ENSMUST00000031366
AA Change: D2173E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031366
Gene: ENSMUSG00000029414
AA Change: D2173E

DomainStartEndE-ValueType
low complexity region 345 357 N/A INTRINSIC
low complexity region 747 764 N/A INTRINSIC
low complexity region 1033 1044 N/A INTRINSIC
Pfam:Rod_C 1579 2128 3.2e-256 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197002
Predicted Effect probably benign
Transcript: ENSMUST00000197265
Meta Mutation Damage Score 0.1335 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. Experimental evidence indicated that the encoded protein functioned in a similar manner to that of the Drosophila rough deal protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice have a kinked tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Kntc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Kntc1 APN 5 123,928,222 (GRCm39) missense probably benign 0.05
IGL00514:Kntc1 APN 5 123,929,590 (GRCm39) missense probably benign 0.00
IGL01103:Kntc1 APN 5 123,902,283 (GRCm39) missense probably damaging 0.96
IGL01106:Kntc1 APN 5 123,900,666 (GRCm39) missense probably benign 0.01
IGL01357:Kntc1 APN 5 123,895,877 (GRCm39) missense probably damaging 1.00
IGL01367:Kntc1 APN 5 123,896,546 (GRCm39) missense probably damaging 1.00
IGL01538:Kntc1 APN 5 123,919,721 (GRCm39) missense probably damaging 1.00
IGL01546:Kntc1 APN 5 123,903,068 (GRCm39) missense probably benign 0.02
IGL01595:Kntc1 APN 5 123,941,758 (GRCm39) missense probably benign 0.30
IGL01725:Kntc1 APN 5 123,902,253 (GRCm39) missense probably benign
IGL01916:Kntc1 APN 5 123,939,976 (GRCm39) missense probably damaging 1.00
IGL01936:Kntc1 APN 5 123,949,439 (GRCm39) missense probably damaging 1.00
IGL01942:Kntc1 APN 5 123,916,330 (GRCm39) missense probably damaging 1.00
IGL01973:Kntc1 APN 5 123,904,021 (GRCm39) missense probably damaging 1.00
IGL01982:Kntc1 APN 5 123,947,159 (GRCm39) missense probably benign 0.12
IGL02145:Kntc1 APN 5 123,900,661 (GRCm39) missense possibly damaging 0.80
IGL02510:Kntc1 APN 5 123,957,125 (GRCm39) missense probably benign 0.03
IGL02611:Kntc1 APN 5 123,950,128 (GRCm39) missense probably damaging 1.00
IGL02669:Kntc1 APN 5 123,893,727 (GRCm39) splice site probably benign
IGL02737:Kntc1 APN 5 123,957,183 (GRCm39) missense probably benign 0.17
IGL02793:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02809:Kntc1 APN 5 123,914,645 (GRCm39) missense probably damaging 1.00
IGL02860:Kntc1 APN 5 123,907,936 (GRCm39) missense possibly damaging 0.49
IGL02875:Kntc1 APN 5 123,916,340 (GRCm39) splice site probably null
IGL02931:Kntc1 APN 5 123,937,874 (GRCm39) missense probably damaging 1.00
IGL03169:Kntc1 APN 5 123,913,884 (GRCm39) missense possibly damaging 0.80
IGL03267:Kntc1 APN 5 123,896,543 (GRCm39) missense probably damaging 1.00
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0006:Kntc1 UTSW 5 123,927,201 (GRCm39) missense probably benign 0.19
R0017:Kntc1 UTSW 5 123,919,044 (GRCm39) missense probably damaging 1.00
R0125:Kntc1 UTSW 5 123,903,120 (GRCm39) splice site probably benign
R0324:Kntc1 UTSW 5 123,916,175 (GRCm39) missense probably damaging 1.00
R0580:Kntc1 UTSW 5 123,941,732 (GRCm39) missense probably benign 0.00
R0608:Kntc1 UTSW 5 123,924,137 (GRCm39) missense probably damaging 0.98
R0725:Kntc1 UTSW 5 123,907,767 (GRCm39) missense possibly damaging 0.92
R0733:Kntc1 UTSW 5 123,928,979 (GRCm39) missense probably null
R0781:Kntc1 UTSW 5 123,937,965 (GRCm39) splice site probably benign
R0787:Kntc1 UTSW 5 123,934,167 (GRCm39) missense probably benign
R1250:Kntc1 UTSW 5 123,922,262 (GRCm39) missense possibly damaging 0.71
R1253:Kntc1 UTSW 5 123,948,925 (GRCm39) frame shift probably null
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1467:Kntc1 UTSW 5 123,925,047 (GRCm39) missense probably benign 0.04
R1481:Kntc1 UTSW 5 123,916,338 (GRCm39) missense probably benign 0.00
R1572:Kntc1 UTSW 5 123,910,176 (GRCm39) missense probably damaging 0.99
R1624:Kntc1 UTSW 5 123,896,540 (GRCm39) missense possibly damaging 0.48
R1749:Kntc1 UTSW 5 123,927,162 (GRCm39) missense probably benign 0.00
R1993:Kntc1 UTSW 5 123,948,874 (GRCm39) critical splice acceptor site probably null
R1993:Kntc1 UTSW 5 123,897,162 (GRCm39) critical splice donor site probably null
R2071:Kntc1 UTSW 5 123,932,340 (GRCm39) splice site probably null
R2237:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2239:Kntc1 UTSW 5 123,941,733 (GRCm39) missense possibly damaging 0.50
R2366:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2367:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2382:Kntc1 UTSW 5 123,898,411 (GRCm39) missense probably damaging 0.99
R2389:Kntc1 UTSW 5 123,919,255 (GRCm39) missense probably damaging 1.00
R2413:Kntc1 UTSW 5 123,902,212 (GRCm39) missense probably benign 0.01
R2442:Kntc1 UTSW 5 123,948,922 (GRCm39) missense probably damaging 1.00
R2504:Kntc1 UTSW 5 123,916,410 (GRCm39) nonsense probably null
R2943:Kntc1 UTSW 5 123,935,847 (GRCm39) missense possibly damaging 0.68
R3116:Kntc1 UTSW 5 123,940,121 (GRCm39) missense probably damaging 1.00
R4107:Kntc1 UTSW 5 123,900,661 (GRCm39) missense probably damaging 0.99
R4176:Kntc1 UTSW 5 123,914,680 (GRCm39) missense possibly damaging 0.76
R4275:Kntc1 UTSW 5 123,905,842 (GRCm39) missense probably damaging 1.00
R4440:Kntc1 UTSW 5 123,932,216 (GRCm39) missense probably damaging 1.00
R4575:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4576:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4578:Kntc1 UTSW 5 123,904,018 (GRCm39) missense probably damaging 1.00
R4612:Kntc1 UTSW 5 123,950,706 (GRCm39) missense probably damaging 1.00
R4704:Kntc1 UTSW 5 123,949,496 (GRCm39) missense probably damaging 0.96
R4720:Kntc1 UTSW 5 123,903,086 (GRCm39) missense possibly damaging 0.65
R4784:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4785:Kntc1 UTSW 5 123,954,825 (GRCm39) missense possibly damaging 0.89
R4824:Kntc1 UTSW 5 123,928,196 (GRCm39) nonsense probably null
R4847:Kntc1 UTSW 5 123,940,337 (GRCm39) missense probably benign 0.18
R4849:Kntc1 UTSW 5 123,897,128 (GRCm39) missense probably benign 0.02
R4904:Kntc1 UTSW 5 123,916,396 (GRCm39) missense possibly damaging 0.47
R4922:Kntc1 UTSW 5 123,940,309 (GRCm39) missense probably damaging 0.99
R5080:Kntc1 UTSW 5 123,900,649 (GRCm39) missense possibly damaging 0.68
R5114:Kntc1 UTSW 5 123,919,118 (GRCm39) critical splice donor site probably null
R5171:Kntc1 UTSW 5 123,937,907 (GRCm39) missense probably benign 0.01
R5220:Kntc1 UTSW 5 123,950,160 (GRCm39) missense probably damaging 1.00
R5226:Kntc1 UTSW 5 123,932,235 (GRCm39) missense probably benign 0.09
R5278:Kntc1 UTSW 5 123,919,077 (GRCm39) missense probably damaging 1.00
R5329:Kntc1 UTSW 5 123,902,254 (GRCm39) missense probably benign 0.02
R5496:Kntc1 UTSW 5 123,922,245 (GRCm39) missense probably benign 0.00
R5633:Kntc1 UTSW 5 123,957,120 (GRCm39) missense probably damaging 0.99
R5638:Kntc1 UTSW 5 123,956,538 (GRCm39) missense possibly damaging 0.65
R5697:Kntc1 UTSW 5 123,903,070 (GRCm39) missense probably benign 0.00
R5757:Kntc1 UTSW 5 123,945,372 (GRCm39) critical splice donor site probably null
R5773:Kntc1 UTSW 5 123,932,220 (GRCm39) missense probably damaging 1.00
R5940:Kntc1 UTSW 5 123,924,258 (GRCm39) missense probably benign 0.05
R6019:Kntc1 UTSW 5 123,900,579 (GRCm39) missense probably benign 0.03
R6230:Kntc1 UTSW 5 123,927,072 (GRCm39) splice site probably null
R6437:Kntc1 UTSW 5 123,907,754 (GRCm39) missense probably damaging 0.98
R6888:Kntc1 UTSW 5 123,949,373 (GRCm39) missense probably damaging 1.00
R6907:Kntc1 UTSW 5 123,939,888 (GRCm39) missense probably damaging 1.00
R7123:Kntc1 UTSW 5 123,919,789 (GRCm39) missense probably damaging 1.00
R7262:Kntc1 UTSW 5 123,925,036 (GRCm39) missense probably benign 0.18
R7381:Kntc1 UTSW 5 123,948,971 (GRCm39) missense probably benign 0.12
R7485:Kntc1 UTSW 5 123,925,019 (GRCm39) missense possibly damaging 0.79
R7512:Kntc1 UTSW 5 123,929,001 (GRCm39) missense probably damaging 1.00
R7581:Kntc1 UTSW 5 123,954,818 (GRCm39) missense probably benign 0.05
R7687:Kntc1 UTSW 5 123,897,152 (GRCm39) missense probably benign 0.01
R7798:Kntc1 UTSW 5 123,957,180 (GRCm39) missense possibly damaging 0.94
R7798:Kntc1 UTSW 5 123,924,357 (GRCm39) missense probably benign
R7871:Kntc1 UTSW 5 123,922,290 (GRCm39) missense probably damaging 1.00
R7876:Kntc1 UTSW 5 123,913,850 (GRCm39) missense probably damaging 1.00
R7947:Kntc1 UTSW 5 123,919,951 (GRCm39) missense unknown
R7997:Kntc1 UTSW 5 123,916,117 (GRCm39) missense probably damaging 0.96
R8231:Kntc1 UTSW 5 123,920,959 (GRCm39) missense possibly damaging 0.47
R8257:Kntc1 UTSW 5 123,896,586 (GRCm39) critical splice donor site probably null
R8345:Kntc1 UTSW 5 123,924,993 (GRCm39) missense probably benign 0.37
R8354:Kntc1 UTSW 5 123,916,330 (GRCm39) missense probably damaging 1.00
R8732:Kntc1 UTSW 5 123,928,180 (GRCm39) missense probably benign 0.00
R8754:Kntc1 UTSW 5 123,897,115 (GRCm39) missense probably benign 0.01
R8947:Kntc1 UTSW 5 123,925,041 (GRCm39) missense probably benign 0.01
R9041:Kntc1 UTSW 5 123,927,093 (GRCm39) missense probably benign 0.00
R9182:Kntc1 UTSW 5 123,940,355 (GRCm39) missense probably damaging 1.00
R9432:Kntc1 UTSW 5 123,925,112 (GRCm39) missense possibly damaging 0.93
R9460:Kntc1 UTSW 5 123,941,378 (GRCm39) nonsense probably null
R9468:Kntc1 UTSW 5 123,954,776 (GRCm39) missense probably damaging 1.00
R9643:Kntc1 UTSW 5 123,949,440 (GRCm39) missense probably damaging 1.00
R9646:Kntc1 UTSW 5 123,897,119 (GRCm39) missense probably benign 0.01
R9721:Kntc1 UTSW 5 123,939,948 (GRCm39) missense probably benign 0.01
R9789:Kntc1 UTSW 5 123,898,706 (GRCm39) missense possibly damaging 0.87
X0027:Kntc1 UTSW 5 123,948,992 (GRCm39) missense probably benign 0.00
X0065:Kntc1 UTSW 5 123,916,100 (GRCm39) nonsense probably null
X0067:Kntc1 UTSW 5 123,916,137 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGGAGTGACAGTTTGAGCTAC -3'
(R):5'- GTGCACATAGTAGTTGATAACGACG -3'

Sequencing Primer
(F):5'- GCTACAGTTGATTCGTACACTAGACC -3'
(R):5'- CTTGGACCACATAGTGAGCTCATG -3'
Posted On 2016-10-05