Incidental Mutation 'R5503:Napa'
ID430732
Institutional Source Beutler Lab
Gene Symbol Napa
Ensembl Gene ENSMUSG00000006024
Gene NameN-ethylmaleimide sensitive fusion protein attachment protein alpha
SynonymsSNAPA, SNARE, 1500039N14Rik, a-SNAP, RA81, hyh
MMRRC Submission 043064-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5503 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16098458-16117975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16115624 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 254 (Q254K)
Ref Sequence ENSEMBL: ENSMUSP00000006181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006178] [ENSMUST00000006181] [ENSMUST00000127637]
Predicted Effect probably benign
Transcript: ENSMUST00000006178
SMART Domains Protein: ENSMUSP00000006178
Gene: ENSMUSG00000006021

DomainStartEndE-ValueType
low complexity region 288 300 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000006181
AA Change: Q254K

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000006181
Gene: ENSMUSG00000006024
AA Change: Q254K

DomainStartEndE-ValueType
Pfam:SNAP 8 288 4.5e-113 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124563
Predicted Effect probably benign
Transcript: ENSMUST00000127637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152044
Meta Mutation Damage Score 0.0974 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: The homozygous null mutation is embryonic lethal while partial loss of function homozygous mutants develop hydrocephalus and die postnatally. These mutants also display central nervous system abnormalities and impaired motor capabilities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Napa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Napa APN 7 16098744 missense possibly damaging 0.66
IGL02383:Napa APN 7 16112578 splice site probably benign
IGL02968:Napa APN 7 16113341 splice site probably benign
R0782:Napa UTSW 7 16115267 missense probably benign 0.00
R2067:Napa UTSW 7 16115278 unclassified probably benign
R2115:Napa UTSW 7 16114209 missense possibly damaging 0.91
R2360:Napa UTSW 7 16114158 missense probably damaging 1.00
R4762:Napa UTSW 7 16115271 missense probably benign 0.22
R5386:Napa UTSW 7 16116472 missense probably benign 0.01
R6335:Napa UTSW 7 16115637 missense probably benign 0.01
R6939:Napa UTSW 7 16115257 missense possibly damaging 0.94
R6961:Napa UTSW 7 16109109 nonsense probably null
R7841:Napa UTSW 7 16115634 missense possibly damaging 0.94
R7924:Napa UTSW 7 16115634 missense possibly damaging 0.94
X0025:Napa UTSW 7 16115212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAGTTAACGCAGGGACCG -3'
(R):5'- CCTAGAGTTCAAGTAGGGCAG -3'

Sequencing Primer
(F):5'- TTAACGCAGGGACCGTGGAG -3'
(R):5'- AACTTGTTCTGTAGACCAGGCTGAC -3'
Posted On2016-10-05