Mutagenetix > Incidental Mutations

Incidental Mutation 'R5503:Napa'

430732

Institutional Source

Beutler Lab

Gene Symbol

Napa

Ensembl Gene

ENSMUSG00000006024

Gene Name

N-ethylmaleimide sensitive fusion protein attachment protein alpha

Synonyms

SNAPA, SNARE, 1500039N14Rik, a-SNAP, RA81, hyh

MMRRC Submission

043064-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16098458-16117975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 16115624 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 254 (Q254K)

Ref Sequence

ENSEMBL: ENSMUSP00000006181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006178] [ENSMUST00000006181] [ENSMUST00000127637]

Predicted Effect

probably benign
Transcript: ENSMUST00000006178

SMART Domains

Protein: ENSMUSP00000006178
Gene: ENSMUSG00000006021

Domain	Start	End	E-Value	Type
low complexity region	288	300	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000006181
AA Change: Q254K

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000006181
Gene: ENSMUSG00000006024
AA Change: Q254K

Domain	Start	End	E-Value	Type
Pfam:SNAP	8	288	4.5e-113	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124563

Predicted Effect

probably benign
Transcript: ENSMUST00000127637

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130170

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140640

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149255

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149388

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152044

Meta Mutation Damage Score

0.0974

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: The homozygous null mutation is embryonic lethal while partial loss of function homozygous mutants develop hydrocephalus and die postnatally. These mutants also display central nervous system abnormalities and impaired motor capabilities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Napa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01760:Napa	APN	7	16098744	missense	possibly damaging	0.66
IGL02383:Napa	APN	7	16112578	splice site	probably benign
IGL02968:Napa	APN	7	16113341	splice site	probably benign
R0782:Napa	UTSW	7	16115267	missense	probably benign	0.00
R2067:Napa	UTSW	7	16115278	unclassified	probably benign
R2115:Napa	UTSW	7	16114209	missense	possibly damaging	0.91
R2360:Napa	UTSW	7	16114158	missense	probably damaging	1.00
R4762:Napa	UTSW	7	16115271	missense	probably benign	0.22
R5386:Napa	UTSW	7	16116472	missense	probably benign	0.01
R6335:Napa	UTSW	7	16115637	missense	probably benign	0.01
R6939:Napa	UTSW	7	16115257	missense	possibly damaging	0.94
R6961:Napa	UTSW	7	16109109	nonsense	probably null
R7841:Napa	UTSW	7	16115634	missense	possibly damaging	0.94
R7924:Napa	UTSW	7	16115634	missense	possibly damaging	0.94
X0025:Napa	UTSW	7	16115212	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TACAGTTAACGCAGGGACCG -3'
(R):5'- CCTAGAGTTCAAGTAGGGCAG -3'

Sequencing Primer
(F):5'- TTAACGCAGGGACCGTGGAG -3'
(R):5'- AACTTGTTCTGTAGACCAGGCTGAC -3'

Posted On

2016-10-05