Incidental Mutation 'R5503:Or13a17'
ID 430736
Institutional Source Beutler Lab
Gene Symbol Or13a17
Ensembl Gene ENSMUSG00000066122
Gene Name olfactory receptor family 13 subfamily A member 17
Synonyms IB6, Olfr45, MOR253-2, GA_x6K02T2PBJ9-42837030-42837962
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.068) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140270797-140271832 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 140271309 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 164 (M164L)
Ref Sequence ENSEMBL: ENSMUSP00000149309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084454] [ENSMUST00000210241] [ENSMUST00000214637]
AlphaFold Q8VGM1
Predicted Effect probably benign
Transcript: ENSMUST00000084454
AA Change: M164L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081492
Gene: ENSMUSG00000066122
AA Change: M164L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.8e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 176 1.2e-7 PFAM
Pfam:7tm_1 42 291 3.7e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210241
AA Change: M164L
Predicted Effect probably benign
Transcript: ENSMUST00000214637
AA Change: M164L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.2540 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Or13a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Or13a17 APN 7 140,271,349 (GRCm39) missense probably damaging 1.00
IGL01434:Or13a17 APN 7 140,271,531 (GRCm39) missense probably damaging 1.00
IGL01697:Or13a17 APN 7 140,271,565 (GRCm39) missense possibly damaging 0.61
IGL02167:Or13a17 APN 7 140,271,664 (GRCm39) missense probably damaging 0.98
IGL02388:Or13a17 APN 7 140,271,024 (GRCm39) missense probably benign 0.00
IGL03054:Or13a17 UTSW 7 140,271,623 (GRCm39) missense probably benign 0.10
R0107:Or13a17 UTSW 7 140,271,258 (GRCm39) missense probably benign
R0403:Or13a17 UTSW 7 140,271,222 (GRCm39) missense possibly damaging 0.80
R1344:Or13a17 UTSW 7 140,271,712 (GRCm39) missense probably damaging 0.98
R1859:Or13a17 UTSW 7 140,271,571 (GRCm39) missense possibly damaging 0.80
R2871:Or13a17 UTSW 7 140,271,198 (GRCm39) missense possibly damaging 0.95
R2871:Or13a17 UTSW 7 140,271,198 (GRCm39) missense possibly damaging 0.95
R3611:Or13a17 UTSW 7 140,271,013 (GRCm39) missense probably benign 0.01
R3915:Or13a17 UTSW 7 140,270,888 (GRCm39) missense probably benign
R4551:Or13a17 UTSW 7 140,271,655 (GRCm39) missense probably damaging 1.00
R4552:Or13a17 UTSW 7 140,271,655 (GRCm39) missense probably damaging 1.00
R4627:Or13a17 UTSW 7 140,271,291 (GRCm39) missense probably benign 0.00
R4628:Or13a17 UTSW 7 140,271,291 (GRCm39) missense probably benign 0.00
R4629:Or13a17 UTSW 7 140,271,291 (GRCm39) missense probably benign 0.00
R4990:Or13a17 UTSW 7 140,271,360 (GRCm39) missense probably damaging 0.99
R7861:Or13a17 UTSW 7 140,271,484 (GRCm39) missense probably damaging 1.00
R8077:Or13a17 UTSW 7 140,271,046 (GRCm39) missense probably benign 0.16
R8268:Or13a17 UTSW 7 140,271,430 (GRCm39) missense probably damaging 1.00
R8532:Or13a17 UTSW 7 140,271,712 (GRCm39) missense probably damaging 0.98
R8978:Or13a17 UTSW 7 140,271,642 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCAGCATCTTCTGAGCTGC -3'
(R):5'- AGAAAAGGCCTTCCTCTTGCC -3'

Sequencing Primer
(F):5'- CTGCTGCTCACGGTCATG -3'
(R):5'- TCAGCAGAACGCATGCG -3'
Posted On 2016-10-05