Incidental Mutation 'R5503:Misp'
ID 430747
Institutional Source Beutler Lab
Gene Symbol Misp
Ensembl Gene ENSMUSG00000035852
Gene Name mitotic spindle positioning
Synonyms 9130017N09Rik
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R5503 (G1)
Quality Score 196
Status Validated
Chromosome 10
Chromosomal Location 79820989-79830490 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79826718 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 323 (R323K)
Ref Sequence ENSEMBL: ENSMUSP00000151529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046833] [ENSMUST00000169041] [ENSMUST00000218687] [ENSMUST00000219305] [ENSMUST00000219734]
AlphaFold Q9D279
Predicted Effect probably damaging
Transcript: ENSMUST00000046833
AA Change: R323K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000048893
Gene: ENSMUSG00000035852
AA Change: R323K

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 2.2e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169041
AA Change: R323K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130071
Gene: ENSMUSG00000035852
AA Change: R323K

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 1.7e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218531
Predicted Effect probably benign
Transcript: ENSMUST00000218687
Predicted Effect probably damaging
Transcript: ENSMUST00000219305
AA Change: R323K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000219734
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin-bundling protein involved in determining cell morphology and mitotic progression. The encoded protein is required for the proper positioning of the mitotic spindle. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Misp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Misp APN 10 79827871 unclassified probably benign
IGL02565:Misp APN 10 79826343 missense probably benign 0.33
IGL02901:Misp APN 10 79826937 missense possibly damaging 0.70
R1118:Misp UTSW 10 79827135 missense probably benign 0.01
R1421:Misp UTSW 10 79826847 missense probably damaging 1.00
R1656:Misp UTSW 10 79825943 missense possibly damaging 0.75
R2864:Misp UTSW 10 79827038 missense probably benign 0.05
R3786:Misp UTSW 10 79825961 missense probably benign 0.23
R5035:Misp UTSW 10 79827956 missense probably benign 0.01
R5594:Misp UTSW 10 79827143 missense probably damaging 1.00
R5982:Misp UTSW 10 79827894 nonsense probably null
R6066:Misp UTSW 10 79826312 missense possibly damaging 0.66
R6236:Misp UTSW 10 79827122 missense probably benign 0.00
R7103:Misp UTSW 10 79827165 missense probably damaging 1.00
R8170:Misp UTSW 10 79826466 missense probably benign 0.39
R8479:Misp UTSW 10 79827916 missense possibly damaging 0.91
R8961:Misp UTSW 10 79827989 missense probably benign 0.01
R9430:Misp UTSW 10 79825841 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGATCCTGGCAGTCAGAC -3'
(R):5'- GACTTTCCTTGCCTCTGGAG -3'

Sequencing Primer
(F):5'- GGCAGAATCCCCTGAGACC -3'
(R):5'- CTCTGGAGCCGGGTCTGTG -3'
Posted On 2016-10-05