Incidental Mutation 'R5503:Ptprq'
ID 430749
Institutional Source Beutler Lab
Gene Symbol Ptprq
Ensembl Gene ENSMUSG00000035916
Gene Name protein tyrosine phosphatase receptor type Q
Synonyms
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.246) question?
Stock # R5503 (G1)
Quality Score 163
Status Validated
Chromosome 10
Chromosomal Location 107352910-107555912 bp(-) (GRCm39)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 107524189 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000058572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050702]
AlphaFold P0C5E4
Predicted Effect probably null
Transcript: ENSMUST00000050702
SMART Domains Protein: ENSMUSP00000058572
Gene: ENSMUSG00000035916

DomainStartEndE-ValueType
FN3 57 141 3.17e-13 SMART
FN3 156 294 1.55e-7 SMART
FN3 307 384 4.45e-8 SMART
FN3 398 555 1.17e-7 SMART
FN3 569 648 7.06e-11 SMART
FN3 666 743 7.68e-12 SMART
FN3 760 839 1.88e-6 SMART
FN3 855 932 1.33e-6 SMART
FN3 949 1037 2.31e-6 SMART
FN3 1054 1135 1.24e-6 SMART
FN3 1151 1229 2.39e-8 SMART
FN3 1244 1325 6.29e-8 SMART
FN3 1341 1416 2.87e-11 SMART
FN3 1431 1524 2.82e-10 SMART
FN3 1540 1622 6.35e-4 SMART
FN3 1642 1732 7.93e-5 SMART
transmembrane domain 1907 1929 N/A INTRINSIC
PTPc 2003 2262 1.14e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218399
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the type III receptor-like protein-tyrosine phosphatase family. The encoded protein catalyzes the dephosphorylation of phosphotyrosine and phosphatidylinositol and plays roles in cellular proliferation and differentiation. Mutations at this locus have been linked to autosomal recessive deafness. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for targeted mutations show absence of shaft connectors from vestibular hair bundles, postnatal degeneration in cochlear hair-bundle structure, reduced transducer currents but otherwise normal adaptation properties, a progressive loss of basal-coil cochlear hair cells, and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Ptprq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptprq APN 10 107,412,790 (GRCm39) missense probably damaging 0.98
IGL00537:Ptprq APN 10 107,546,383 (GRCm39) missense probably benign 0.07
IGL00547:Ptprq APN 10 107,554,402 (GRCm39) missense probably damaging 0.99
IGL00586:Ptprq APN 10 107,443,983 (GRCm39) splice site probably benign
IGL00648:Ptprq APN 10 107,482,577 (GRCm39) missense probably benign 0.10
IGL01123:Ptprq APN 10 107,522,079 (GRCm39) missense probably damaging 0.96
IGL01343:Ptprq APN 10 107,474,700 (GRCm39) missense probably damaging 0.96
IGL01348:Ptprq APN 10 107,547,765 (GRCm39) missense probably damaging 1.00
IGL01433:Ptprq APN 10 107,412,741 (GRCm39) missense probably damaging 0.99
IGL01510:Ptprq APN 10 107,547,909 (GRCm39) missense probably damaging 1.00
IGL01535:Ptprq APN 10 107,535,457 (GRCm39) missense probably benign
IGL01631:Ptprq APN 10 107,479,399 (GRCm39) missense probably benign 0.00
IGL01633:Ptprq APN 10 107,535,584 (GRCm39) splice site probably benign
IGL01702:Ptprq APN 10 107,353,727 (GRCm39) missense probably benign 0.00
IGL01733:Ptprq APN 10 107,498,460 (GRCm39) missense probably benign 0.10
IGL01806:Ptprq APN 10 107,535,469 (GRCm39) missense probably damaging 1.00
IGL01832:Ptprq APN 10 107,401,700 (GRCm39) critical splice donor site probably null
IGL01961:Ptprq APN 10 107,479,515 (GRCm39) missense probably damaging 1.00
IGL02108:Ptprq APN 10 107,482,478 (GRCm39) missense probably damaging 1.00
IGL02120:Ptprq APN 10 107,503,333 (GRCm39) missense probably damaging 1.00
IGL02160:Ptprq APN 10 107,489,426 (GRCm39) missense probably benign 0.00
IGL02178:Ptprq APN 10 107,522,180 (GRCm39) missense probably benign 0.03
IGL02249:Ptprq APN 10 107,418,220 (GRCm39) missense probably damaging 1.00
IGL02267:Ptprq APN 10 107,482,419 (GRCm39) missense probably damaging 1.00
IGL02527:Ptprq APN 10 107,522,424 (GRCm39) missense probably benign 0.04
IGL02529:Ptprq APN 10 107,471,226 (GRCm39) missense probably benign 0.03
IGL02542:Ptprq APN 10 107,498,416 (GRCm39) missense probably damaging 1.00
IGL02582:Ptprq APN 10 107,479,860 (GRCm39) missense probably benign 0.00
IGL02708:Ptprq APN 10 107,488,561 (GRCm39) missense probably damaging 1.00
IGL02894:Ptprq APN 10 107,503,285 (GRCm39) missense probably benign
IGL02903:Ptprq APN 10 107,502,447 (GRCm39) missense possibly damaging 0.51
IGL02951:Ptprq APN 10 107,503,321 (GRCm39) missense probably benign 0.03
IGL02982:Ptprq APN 10 107,422,545 (GRCm39) missense probably damaging 1.00
IGL03000:Ptprq APN 10 107,378,518 (GRCm39) missense probably damaging 1.00
IGL03024:Ptprq APN 10 107,521,427 (GRCm39) missense possibly damaging 0.69
IGL03240:Ptprq APN 10 107,524,368 (GRCm39) missense probably benign
P0043:Ptprq UTSW 10 107,416,086 (GRCm39) missense probably benign 0.03
PIT4812001:Ptprq UTSW 10 107,502,428 (GRCm39) missense probably damaging 1.00
R0200:Ptprq UTSW 10 107,521,018 (GRCm39) missense probably benign
R0268:Ptprq UTSW 10 107,541,409 (GRCm39) missense probably benign
R0276:Ptprq UTSW 10 107,378,596 (GRCm39) critical splice acceptor site probably null
R0279:Ptprq UTSW 10 107,444,278 (GRCm39) missense probably damaging 0.96
R0335:Ptprq UTSW 10 107,544,589 (GRCm39) missense probably benign
R0344:Ptprq UTSW 10 107,541,443 (GRCm39) missense probably benign
R0357:Ptprq UTSW 10 107,522,060 (GRCm39) splice site probably benign
R0454:Ptprq UTSW 10 107,418,391 (GRCm39) nonsense probably null
R0479:Ptprq UTSW 10 107,479,855 (GRCm39) nonsense probably null
R0491:Ptprq UTSW 10 107,444,036 (GRCm39) missense probably damaging 0.98
R0519:Ptprq UTSW 10 107,374,781 (GRCm39) splice site probably benign
R0523:Ptprq UTSW 10 107,416,081 (GRCm39) missense possibly damaging 0.54
R0553:Ptprq UTSW 10 107,546,488 (GRCm39) missense probably benign 0.33
R0746:Ptprq UTSW 10 107,353,692 (GRCm39) missense probably damaging 1.00
R0755:Ptprq UTSW 10 107,418,400 (GRCm39) missense probably benign 0.09
R1434:Ptprq UTSW 10 107,422,575 (GRCm39) missense probably damaging 1.00
R1445:Ptprq UTSW 10 107,498,423 (GRCm39) missense probably damaging 1.00
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1470:Ptprq UTSW 10 107,554,435 (GRCm39) missense probably damaging 0.97
R1558:Ptprq UTSW 10 107,479,904 (GRCm39) missense probably damaging 1.00
R1567:Ptprq UTSW 10 107,401,748 (GRCm39) missense probably benign 0.13
R1711:Ptprq UTSW 10 107,370,560 (GRCm39) nonsense probably null
R1720:Ptprq UTSW 10 107,522,155 (GRCm39) missense probably damaging 1.00
R1746:Ptprq UTSW 10 107,474,691 (GRCm39) missense probably damaging 1.00
R1776:Ptprq UTSW 10 107,520,950 (GRCm39) missense probably damaging 1.00
R1822:Ptprq UTSW 10 107,554,339 (GRCm39) missense probably damaging 1.00
R1872:Ptprq UTSW 10 107,479,860 (GRCm39) missense probably benign 0.19
R1944:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R1945:Ptprq UTSW 10 107,418,249 (GRCm39) missense probably benign 0.23
R2006:Ptprq UTSW 10 107,502,407 (GRCm39) missense probably damaging 1.00
R2014:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2015:Ptprq UTSW 10 107,503,283 (GRCm39) missense probably damaging 0.96
R2097:Ptprq UTSW 10 107,489,354 (GRCm39) missense probably benign 0.05
R2172:Ptprq UTSW 10 107,426,855 (GRCm39) nonsense probably null
R2174:Ptprq UTSW 10 107,541,414 (GRCm39) missense probably damaging 1.00
R2248:Ptprq UTSW 10 107,478,931 (GRCm39) splice site probably null
R2404:Ptprq UTSW 10 107,522,460 (GRCm39) missense probably damaging 1.00
R3423:Ptprq UTSW 10 107,418,337 (GRCm39) missense probably damaging 0.99
R3683:Ptprq UTSW 10 107,544,489 (GRCm39) missense probably benign 0.01
R3875:Ptprq UTSW 10 107,520,965 (GRCm39) missense possibly damaging 0.88
R3945:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3946:Ptprq UTSW 10 107,522,253 (GRCm39) splice site probably benign
R3974:Ptprq UTSW 10 107,547,923 (GRCm39) missense possibly damaging 0.88
R3982:Ptprq UTSW 10 107,379,257 (GRCm39) missense probably damaging 0.99
R4105:Ptprq UTSW 10 107,408,828 (GRCm39) missense probably damaging 1.00
R4118:Ptprq UTSW 10 107,547,781 (GRCm39) missense probably benign 0.37
R4175:Ptprq UTSW 10 107,547,778 (GRCm39) missense probably benign
R4231:Ptprq UTSW 10 107,522,144 (GRCm39) nonsense probably null
R4356:Ptprq UTSW 10 107,444,225 (GRCm39) missense probably damaging 0.99
R4435:Ptprq UTSW 10 107,520,916 (GRCm39) missense possibly damaging 0.89
R4678:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4679:Ptprq UTSW 10 107,521,043 (GRCm39) missense probably benign 0.19
R4745:Ptprq UTSW 10 107,360,114 (GRCm39) missense probably damaging 1.00
R4771:Ptprq UTSW 10 107,524,288 (GRCm39) missense probably benign
R4778:Ptprq UTSW 10 107,426,883 (GRCm39) missense probably benign 0.15
R4808:Ptprq UTSW 10 107,554,368 (GRCm39) missense probably damaging 1.00
R4809:Ptprq UTSW 10 107,399,036 (GRCm39) missense probably damaging 1.00
R4818:Ptprq UTSW 10 107,546,442 (GRCm39) missense possibly damaging 0.86
R4845:Ptprq UTSW 10 107,489,393 (GRCm39) missense probably benign 0.00
R4901:Ptprq UTSW 10 107,524,275 (GRCm39) missense probably benign 0.01
R4942:Ptprq UTSW 10 107,524,290 (GRCm39) missense probably benign 0.01
R4946:Ptprq UTSW 10 107,361,595 (GRCm39) missense probably benign
R4959:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R4973:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R5007:Ptprq UTSW 10 107,444,137 (GRCm39) missense probably benign 0.00
R5053:Ptprq UTSW 10 107,399,063 (GRCm39) missense probably damaging 1.00
R5055:Ptprq UTSW 10 107,370,540 (GRCm39) missense probably benign 0.37
R5090:Ptprq UTSW 10 107,361,950 (GRCm39) missense probably damaging 1.00
R5158:Ptprq UTSW 10 107,370,565 (GRCm39) missense probably damaging 1.00
R5163:Ptprq UTSW 10 107,360,192 (GRCm39) missense probably damaging 1.00
R5222:Ptprq UTSW 10 107,498,425 (GRCm39) missense probably damaging 0.96
R5244:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R5249:Ptprq UTSW 10 107,535,496 (GRCm39) missense probably damaging 0.99
R5508:Ptprq UTSW 10 107,522,092 (GRCm39) missense probably benign 0.00
R5601:Ptprq UTSW 10 107,444,291 (GRCm39) missense probably benign
R5722:Ptprq UTSW 10 107,522,226 (GRCm39) missense possibly damaging 0.72
R5819:Ptprq UTSW 10 107,555,744 (GRCm39) start gained probably benign
R5862:Ptprq UTSW 10 107,401,739 (GRCm39) missense probably benign 0.02
R5891:Ptprq UTSW 10 107,412,756 (GRCm39) missense possibly damaging 0.94
R5916:Ptprq UTSW 10 107,359,374 (GRCm39) missense probably damaging 1.00
R6054:Ptprq UTSW 10 107,418,219 (GRCm39) missense probably damaging 1.00
R6058:Ptprq UTSW 10 107,471,135 (GRCm39) missense probably benign 0.00
R6075:Ptprq UTSW 10 107,361,621 (GRCm39) missense probably damaging 1.00
R6101:Ptprq UTSW 10 107,416,127 (GRCm39) missense possibly damaging 0.93
R6189:Ptprq UTSW 10 107,353,748 (GRCm39) missense probably damaging 1.00
R6235:Ptprq UTSW 10 107,471,199 (GRCm39) missense possibly damaging 0.61
R6351:Ptprq UTSW 10 107,544,529 (GRCm39) missense probably damaging 0.99
R6394:Ptprq UTSW 10 107,478,804 (GRCm39) nonsense probably null
R6449:Ptprq UTSW 10 107,541,444 (GRCm39) missense probably benign 0.00
R6526:Ptprq UTSW 10 107,378,514 (GRCm39) nonsense probably null
R6544:Ptprq UTSW 10 107,444,102 (GRCm39) missense probably damaging 1.00
R6609:Ptprq UTSW 10 107,408,829 (GRCm39) missense probably damaging 0.99
R6862:Ptprq UTSW 10 107,522,086 (GRCm39) missense probably damaging 0.96
R6874:Ptprq UTSW 10 107,554,460 (GRCm39) missense possibly damaging 0.80
R6892:Ptprq UTSW 10 107,411,865 (GRCm39) missense probably benign 0.00
R7082:Ptprq UTSW 10 107,544,591 (GRCm39) missense probably benign 0.10
R7210:Ptprq UTSW 10 107,521,032 (GRCm39) missense probably damaging 1.00
R7253:Ptprq UTSW 10 107,444,134 (GRCm39) missense probably benign 0.30
R7293:Ptprq UTSW 10 107,471,367 (GRCm39) nonsense probably null
R7445:Ptprq UTSW 10 107,426,820 (GRCm39) missense probably damaging 1.00
R7632:Ptprq UTSW 10 107,547,783 (GRCm39) missense probably benign 0.32
R7685:Ptprq UTSW 10 107,479,839 (GRCm39) missense probably damaging 1.00
R7703:Ptprq UTSW 10 107,480,007 (GRCm39) missense probably benign 0.01
R7774:Ptprq UTSW 10 107,479,530 (GRCm39) missense probably damaging 0.96
R7897:Ptprq UTSW 10 107,546,484 (GRCm39) missense probably benign 0.21
R7936:Ptprq UTSW 10 107,488,572 (GRCm39) missense probably damaging 1.00
R7983:Ptprq UTSW 10 107,444,272 (GRCm39) nonsense probably null
R8023:Ptprq UTSW 10 107,488,477 (GRCm39) nonsense probably null
R8071:Ptprq UTSW 10 107,479,896 (GRCm39) missense possibly damaging 0.62
R8084:Ptprq UTSW 10 107,444,294 (GRCm39) missense probably benign
R8086:Ptprq UTSW 10 107,482,500 (GRCm39) nonsense probably null
R8169:Ptprq UTSW 10 107,418,351 (GRCm39) missense probably damaging 1.00
R8223:Ptprq UTSW 10 107,535,499 (GRCm39) missense probably benign 0.00
R8235:Ptprq UTSW 10 107,541,351 (GRCm39) missense probably benign 0.32
R8235:Ptprq UTSW 10 107,418,402 (GRCm39) missense probably damaging 1.00
R8278:Ptprq UTSW 10 107,522,239 (GRCm39) missense possibly damaging 0.87
R8710:Ptprq UTSW 10 107,411,919 (GRCm39) missense possibly damaging 0.67
R8828:Ptprq UTSW 10 107,482,513 (GRCm39) missense probably benign
R8830:Ptprq UTSW 10 107,422,556 (GRCm39) missense possibly damaging 0.62
R8869:Ptprq UTSW 10 107,535,469 (GRCm39) missense probably damaging 1.00
R9012:Ptprq UTSW 10 107,489,411 (GRCm39) missense probably benign 0.09
R9072:Ptprq UTSW 10 107,401,736 (GRCm39) missense
R9153:Ptprq UTSW 10 107,416,126 (GRCm39) missense probably damaging 0.98
R9202:Ptprq UTSW 10 107,522,416 (GRCm39) missense probably damaging 1.00
R9252:Ptprq UTSW 10 107,522,247 (GRCm39) missense probably benign 0.12
R9306:Ptprq UTSW 10 107,422,599 (GRCm39) missense probably benign 0.00
R9492:Ptprq UTSW 10 107,478,813 (GRCm39) missense probably damaging 1.00
R9519:Ptprq UTSW 10 107,520,961 (GRCm39) missense probably damaging 1.00
R9581:Ptprq UTSW 10 107,547,771 (GRCm39) missense possibly damaging 0.53
R9593:Ptprq UTSW 10 107,524,254 (GRCm39) missense possibly damaging 0.92
R9621:Ptprq UTSW 10 107,378,523 (GRCm39) missense probably damaging 1.00
R9732:Ptprq UTSW 10 107,412,767 (GRCm39) missense probably damaging 1.00
R9743:Ptprq UTSW 10 107,520,982 (GRCm39) missense probably damaging 1.00
R9771:Ptprq UTSW 10 107,521,085 (GRCm39) missense probably damaging 0.99
R9788:Ptprq UTSW 10 107,401,751 (GRCm39) missense probably benign 0.24
Z1088:Ptprq UTSW 10 107,535,533 (GRCm39) missense possibly damaging 0.56
Z1176:Ptprq UTSW 10 107,361,931 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGGGTTCATACCTCGAC -3'
(R):5'- GTCGTGAAGCACTGATTTATTTTC -3'

Sequencing Primer
(F):5'- GGTTCATACCTCGACTAGACACTGG -3'
(R):5'- GTATATAAACAACCCCATGACTCCAG -3'
Posted On 2016-10-05