Incidental Mutation 'R5503:Abca9'
ID 430758
Institutional Source Beutler Lab
Gene Symbol Abca9
Ensembl Gene ENSMUSG00000041797
Gene Name ATP-binding cassette, sub-family A member 9
Synonyms D630040K07Rik
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 109991575-110059022 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 110032436 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 727 (T727M)
Ref Sequence ENSEMBL: ENSMUSP00000036338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044850]
AlphaFold Q8K449
Predicted Effect probably damaging
Transcript: ENSMUST00000044850
AA Change: T727M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: T727M

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 419 2.7e-31 PFAM
AAA 509 693 9.28e-12 SMART
low complexity region 817 837 N/A INTRINSIC
transmembrane domain 862 884 N/A INTRINSIC
Pfam:ABC2_membrane_3 918 1219 5.2e-15 PFAM
low complexity region 1250 1259 N/A INTRINSIC
AAA 1317 1497 8.47e-6 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted(1

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Abca9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Abca9 APN 11 110,051,342 (GRCm39) missense probably benign
IGL00467:Abca9 APN 11 110,036,496 (GRCm39) splice site probably benign
IGL00886:Abca9 APN 11 110,054,101 (GRCm39) missense possibly damaging 0.93
IGL01340:Abca9 APN 11 110,021,453 (GRCm39) missense probably benign
IGL01351:Abca9 APN 11 110,039,729 (GRCm39) missense probably damaging 0.99
IGL01383:Abca9 APN 11 110,004,119 (GRCm39) splice site probably benign
IGL01384:Abca9 APN 11 110,036,463 (GRCm39) missense probably damaging 1.00
IGL01482:Abca9 APN 11 110,011,599 (GRCm39) missense probably benign 0.05
IGL01586:Abca9 APN 11 110,045,243 (GRCm39) missense probably damaging 0.99
IGL01589:Abca9 APN 11 110,046,003 (GRCm39) missense probably damaging 1.00
IGL01926:Abca9 APN 11 110,026,155 (GRCm39) splice site probably benign
IGL02059:Abca9 APN 11 110,051,220 (GRCm39) splice site probably benign
IGL02084:Abca9 APN 11 110,021,423 (GRCm39) missense probably benign
IGL02096:Abca9 APN 11 110,056,806 (GRCm39) missense probably benign 0.01
IGL02096:Abca9 APN 11 109,993,359 (GRCm39) missense probably damaging 1.00
IGL02290:Abca9 APN 11 110,026,177 (GRCm39) missense probably damaging 1.00
IGL02303:Abca9 APN 11 110,045,376 (GRCm39) missense probably damaging 1.00
IGL02549:Abca9 APN 11 109,992,879 (GRCm39) missense probably damaging 1.00
IGL02687:Abca9 APN 11 110,005,058 (GRCm39) missense probably damaging 1.00
IGL02752:Abca9 APN 11 110,018,194 (GRCm39) missense probably damaging 1.00
IGL02814:Abca9 APN 11 110,045,293 (GRCm39) missense possibly damaging 0.90
IGL02878:Abca9 APN 11 110,029,155 (GRCm39) missense probably benign 0.01
IGL03088:Abca9 APN 11 110,035,087 (GRCm39) missense probably benign 0.06
IGL03231:Abca9 APN 11 110,046,094 (GRCm39) missense probably damaging 0.96
R0050:Abca9 UTSW 11 110,036,417 (GRCm39) missense probably damaging 1.00
R0050:Abca9 UTSW 11 110,036,417 (GRCm39) missense probably damaging 1.00
R0064:Abca9 UTSW 11 110,035,698 (GRCm39) missense probably damaging 1.00
R0064:Abca9 UTSW 11 110,035,697 (GRCm39) missense probably damaging 1.00
R0068:Abca9 UTSW 11 110,036,405 (GRCm39) missense probably damaging 0.99
R0189:Abca9 UTSW 11 110,032,488 (GRCm39) splice site probably benign
R0189:Abca9 UTSW 11 109,999,479 (GRCm39) missense probably damaging 1.00
R0375:Abca9 UTSW 11 110,006,273 (GRCm39) missense probably benign 0.00
R0601:Abca9 UTSW 11 110,007,884 (GRCm39) critical splice donor site probably null
R0624:Abca9 UTSW 11 110,030,446 (GRCm39) missense probably damaging 1.00
R0652:Abca9 UTSW 11 110,042,889 (GRCm39) missense probably benign 0.02
R1004:Abca9 UTSW 11 110,042,780 (GRCm39) missense possibly damaging 0.88
R1222:Abca9 UTSW 11 110,035,890 (GRCm39) splice site probably benign
R1451:Abca9 UTSW 11 110,018,273 (GRCm39) missense probably damaging 1.00
R1462:Abca9 UTSW 11 110,051,342 (GRCm39) missense probably benign
R1462:Abca9 UTSW 11 110,051,342 (GRCm39) missense probably benign
R1474:Abca9 UTSW 11 110,036,405 (GRCm39) missense probably damaging 0.99
R1499:Abca9 UTSW 11 110,030,458 (GRCm39) missense probably benign 0.00
R1778:Abca9 UTSW 11 110,021,542 (GRCm39) nonsense probably null
R2015:Abca9 UTSW 11 110,022,672 (GRCm39) missense probably benign 0.01
R2295:Abca9 UTSW 11 110,039,729 (GRCm39) missense probably damaging 0.99
R2303:Abca9 UTSW 11 110,049,052 (GRCm39) missense probably benign 0.01
R2403:Abca9 UTSW 11 110,006,280 (GRCm39) missense probably benign 0.16
R2886:Abca9 UTSW 11 110,035,712 (GRCm39) splice site probably benign
R3435:Abca9 UTSW 11 110,045,256 (GRCm39) missense probably benign 0.24
R3976:Abca9 UTSW 11 110,039,615 (GRCm39) missense probably benign 0.25
R4335:Abca9 UTSW 11 110,042,843 (GRCm39) missense probably damaging 1.00
R4411:Abca9 UTSW 11 110,042,781 (GRCm39) missense probably benign 0.00
R4613:Abca9 UTSW 11 110,035,610 (GRCm39) missense probably benign 0.26
R4690:Abca9 UTSW 11 110,039,706 (GRCm39) missense probably damaging 1.00
R4720:Abca9 UTSW 11 110,018,248 (GRCm39) missense probably damaging 1.00
R4751:Abca9 UTSW 11 110,021,396 (GRCm39) missense probably benign 0.00
R4797:Abca9 UTSW 11 110,008,945 (GRCm39) missense probably benign
R4818:Abca9 UTSW 11 110,045,980 (GRCm39) critical splice donor site probably null
R4903:Abca9 UTSW 11 110,037,827 (GRCm39) missense probably damaging 1.00
R4971:Abca9 UTSW 11 110,042,874 (GRCm39) missense probably benign 0.43
R4977:Abca9 UTSW 11 110,026,899 (GRCm39) missense probably benign 0.00
R5019:Abca9 UTSW 11 110,056,760 (GRCm39) missense probably benign
R5079:Abca9 UTSW 11 110,036,395 (GRCm39) missense possibly damaging 0.47
R5082:Abca9 UTSW 11 110,022,694 (GRCm39) missense probably benign
R5093:Abca9 UTSW 11 110,032,358 (GRCm39) missense probably damaging 0.98
R5212:Abca9 UTSW 11 109,998,052 (GRCm39) missense probably benign 0.02
R5350:Abca9 UTSW 11 110,006,364 (GRCm39) missense probably benign
R5368:Abca9 UTSW 11 110,036,372 (GRCm39) missense probably damaging 1.00
R5432:Abca9 UTSW 11 110,032,380 (GRCm39) missense possibly damaging 0.83
R5436:Abca9 UTSW 11 110,025,062 (GRCm39) missense probably damaging 1.00
R5497:Abca9 UTSW 11 110,021,518 (GRCm39) missense probably damaging 1.00
R5594:Abca9 UTSW 11 110,035,688 (GRCm39) missense probably damaging 1.00
R5742:Abca9 UTSW 11 110,051,243 (GRCm39) missense probably damaging 0.98
R5776:Abca9 UTSW 11 109,998,286 (GRCm39) splice site probably null
R5781:Abca9 UTSW 11 109,992,813 (GRCm39) missense probably damaging 1.00
R5872:Abca9 UTSW 11 110,007,902 (GRCm39) missense possibly damaging 0.70
R5923:Abca9 UTSW 11 110,051,378 (GRCm39) missense probably benign 0.09
R6020:Abca9 UTSW 11 110,036,439 (GRCm39) missense possibly damaging 0.86
R6179:Abca9 UTSW 11 110,025,080 (GRCm39) missense probably benign 0.05
R6245:Abca9 UTSW 11 110,026,249 (GRCm39) missense probably damaging 1.00
R6249:Abca9 UTSW 11 110,036,453 (GRCm39) missense probably benign
R6365:Abca9 UTSW 11 110,036,481 (GRCm39) missense possibly damaging 0.63
R6385:Abca9 UTSW 11 110,025,080 (GRCm39) missense probably damaging 0.99
R6481:Abca9 UTSW 11 110,056,788 (GRCm39) nonsense probably null
R6675:Abca9 UTSW 11 110,006,302 (GRCm39) missense probably benign
R6909:Abca9 UTSW 11 110,006,323 (GRCm39) missense probably benign 0.01
R7390:Abca9 UTSW 11 110,036,487 (GRCm39) missense probably benign 0.01
R7429:Abca9 UTSW 11 110,018,252 (GRCm39) frame shift probably null
R7431:Abca9 UTSW 11 110,018,252 (GRCm39) frame shift probably null
R7621:Abca9 UTSW 11 110,051,359 (GRCm39) missense probably benign 0.00
R7623:Abca9 UTSW 11 109,998,384 (GRCm39) missense probably benign 0.27
R7660:Abca9 UTSW 11 110,006,278 (GRCm39) missense probably benign
R7784:Abca9 UTSW 11 110,045,243 (GRCm39) nonsense probably null
R7798:Abca9 UTSW 11 110,029,005 (GRCm39) missense probably benign 0.45
R7839:Abca9 UTSW 11 110,025,085 (GRCm39) missense probably benign 0.43
R7891:Abca9 UTSW 11 110,054,098 (GRCm39) missense probably benign 0.03
R7894:Abca9 UTSW 11 109,997,415 (GRCm39) missense possibly damaging 0.49
R8030:Abca9 UTSW 11 110,011,534 (GRCm39) missense probably benign
R8133:Abca9 UTSW 11 110,018,289 (GRCm39) missense possibly damaging 0.88
R8195:Abca9 UTSW 11 110,029,155 (GRCm39) missense probably benign 0.01
R8304:Abca9 UTSW 11 109,997,954 (GRCm39) critical splice donor site probably null
R8386:Abca9 UTSW 11 110,021,518 (GRCm39) missense probably damaging 1.00
R8390:Abca9 UTSW 11 110,036,456 (GRCm39) missense probably benign 0.01
R8692:Abca9 UTSW 11 110,032,409 (GRCm39) missense probably benign 0.11
R8721:Abca9 UTSW 11 110,035,115 (GRCm39) missense possibly damaging 0.82
R8738:Abca9 UTSW 11 110,056,817 (GRCm39) start codon destroyed probably null 1.00
R8900:Abca9 UTSW 11 110,045,218 (GRCm39) missense probably benign
R8948:Abca9 UTSW 11 110,054,206 (GRCm39) critical splice acceptor site probably null
R8950:Abca9 UTSW 11 110,054,206 (GRCm39) critical splice acceptor site probably null
R8964:Abca9 UTSW 11 110,038,075 (GRCm39) nonsense probably null
R9019:Abca9 UTSW 11 110,011,522 (GRCm39) missense
R9034:Abca9 UTSW 11 110,039,615 (GRCm39) missense probably benign 0.25
R9035:Abca9 UTSW 11 110,021,461 (GRCm39) missense probably damaging 0.97
R9086:Abca9 UTSW 11 109,992,879 (GRCm39) missense probably damaging 1.00
R9199:Abca9 UTSW 11 110,056,770 (GRCm39) missense possibly damaging 0.49
R9402:Abca9 UTSW 11 110,049,154 (GRCm39) missense probably benign 0.14
R9414:Abca9 UTSW 11 110,035,100 (GRCm39) missense probably damaging 0.97
R9554:Abca9 UTSW 11 110,029,107 (GRCm39) missense probably benign
R9626:Abca9 UTSW 11 110,011,606 (GRCm39) missense probably benign 0.01
R9651:Abca9 UTSW 11 110,006,319 (GRCm39) missense probably benign 0.09
R9665:Abca9 UTSW 11 110,006,281 (GRCm39) missense probably benign 0.00
R9665:Abca9 UTSW 11 110,006,280 (GRCm39) missense probably benign
R9731:Abca9 UTSW 11 110,025,024 (GRCm39) missense probably benign
Z1176:Abca9 UTSW 11 110,026,201 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCAGACACAGTCCCTCTACG -3'
(R):5'- TGGATTACTATCATTGCATCTAGTTCC -3'

Sequencing Primer
(F):5'- AGACACAGTCCCTCTACGCTTTG -3'
(R):5'- GCATCTAGTTCCTCTCTGTAAATTAC -3'
Posted On 2016-10-05