Incidental Mutation 'R5503:Abca6'
ID 430759
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene Name ATP-binding cassette, sub-family A member 6
Synonyms 6330565N06Rik
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 110067646-110142602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110109083 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 696 (S696P)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
AlphaFold Q8K441
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: S696P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: S696P

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Meta Mutation Damage Score 0.3047 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110,075,535 (GRCm39) missense probably damaging 1.00
IGL00569:Abca6 APN 11 110,077,875 (GRCm39) missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110,087,823 (GRCm39) splice site probably benign
IGL01024:Abca6 APN 11 110,087,968 (GRCm39) missense probably benign
IGL01087:Abca6 APN 11 110,082,476 (GRCm39) missense probably benign 0.00
IGL01511:Abca6 APN 11 110,135,136 (GRCm39) missense probably benign 0.00
IGL01516:Abca6 APN 11 110,109,043 (GRCm39) missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110,075,534 (GRCm39) missense probably damaging 1.00
IGL01749:Abca6 APN 11 110,135,050 (GRCm39) missense probably damaging 1.00
IGL01934:Abca6 APN 11 110,079,481 (GRCm39) missense probably benign 0.00
IGL02010:Abca6 APN 11 110,110,442 (GRCm39) missense probably benign 0.12
IGL02121:Abca6 APN 11 110,073,750 (GRCm39) missense probably benign 0.38
IGL02423:Abca6 APN 11 110,109,832 (GRCm39) splice site probably benign
IGL02428:Abca6 APN 11 110,069,618 (GRCm39) missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110,067,794 (GRCm39) utr 3 prime probably benign
IGL02541:Abca6 APN 11 110,103,093 (GRCm39) missense probably damaging 1.00
IGL02792:Abca6 APN 11 110,079,507 (GRCm39) missense probably damaging 0.99
IGL02836:Abca6 APN 11 110,139,374 (GRCm39) missense probably damaging 1.00
IGL02965:Abca6 APN 11 110,071,439 (GRCm39) missense probably benign
IGL03094:Abca6 APN 11 110,074,938 (GRCm39) missense probably benign 0.03
IGL03109:Abca6 APN 11 110,071,173 (GRCm39) missense probably damaging 0.96
R0068:Abca6 UTSW 11 110,073,708 (GRCm39) missense probably damaging 1.00
R0142:Abca6 UTSW 11 110,079,467 (GRCm39) missense probably damaging 1.00
R0165:Abca6 UTSW 11 110,110,430 (GRCm39) missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110,127,615 (GRCm39) missense probably benign 0.16
R0598:Abca6 UTSW 11 110,087,980 (GRCm39) missense probably damaging 1.00
R0992:Abca6 UTSW 11 110,102,510 (GRCm39) missense probably damaging 1.00
R1386:Abca6 UTSW 11 110,135,081 (GRCm39) missense probably benign 0.02
R1642:Abca6 UTSW 11 110,109,107 (GRCm39) missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110,103,165 (GRCm39) missense probably benign 0.01
R1792:Abca6 UTSW 11 110,074,870 (GRCm39) missense probably benign 0.00
R1813:Abca6 UTSW 11 110,124,671 (GRCm39) splice site probably benign
R1817:Abca6 UTSW 11 110,110,144 (GRCm39) missense probably benign 0.00
R1842:Abca6 UTSW 11 110,087,865 (GRCm39) missense probably benign 0.00
R1898:Abca6 UTSW 11 110,099,625 (GRCm39) missense probably damaging 0.99
R1914:Abca6 UTSW 11 110,103,036 (GRCm39) missense probably benign 0.06
R1915:Abca6 UTSW 11 110,103,036 (GRCm39) missense probably benign 0.06
R1934:Abca6 UTSW 11 110,100,909 (GRCm39) critical splice donor site probably null
R1964:Abca6 UTSW 11 110,075,502 (GRCm39) missense probably damaging 0.98
R1967:Abca6 UTSW 11 110,077,974 (GRCm39) missense probably benign 0.09
R2127:Abca6 UTSW 11 110,110,475 (GRCm39) missense probably benign 0.00
R2128:Abca6 UTSW 11 110,110,475 (GRCm39) missense probably benign 0.00
R2164:Abca6 UTSW 11 110,101,019 (GRCm39) frame shift probably null
R2895:Abca6 UTSW 11 110,093,252 (GRCm39) missense probably benign 0.00
R3110:Abca6 UTSW 11 110,069,655 (GRCm39) nonsense probably null
R3111:Abca6 UTSW 11 110,069,655 (GRCm39) nonsense probably null
R3112:Abca6 UTSW 11 110,069,655 (GRCm39) nonsense probably null
R4094:Abca6 UTSW 11 110,071,192 (GRCm39) missense probably damaging 1.00
R4432:Abca6 UTSW 11 110,132,414 (GRCm39) missense probably benign 0.11
R4474:Abca6 UTSW 11 110,124,598 (GRCm39) missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110,107,374 (GRCm39) missense probably benign 0.31
R4629:Abca6 UTSW 11 110,121,375 (GRCm39) critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110,082,544 (GRCm39) missense probably benign
R4852:Abca6 UTSW 11 110,135,029 (GRCm39) missense probably benign 0.09
R4867:Abca6 UTSW 11 110,093,205 (GRCm39) missense probably benign 0.01
R4879:Abca6 UTSW 11 110,110,526 (GRCm39) missense probably damaging 0.98
R4918:Abca6 UTSW 11 110,071,377 (GRCm39) missense probably damaging 1.00
R5060:Abca6 UTSW 11 110,110,430 (GRCm39) missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110,067,892 (GRCm39) missense probably benign 0.12
R5083:Abca6 UTSW 11 110,109,793 (GRCm39) missense probably damaging 1.00
R5173:Abca6 UTSW 11 110,082,546 (GRCm39) missense probably benign
R5393:Abca6 UTSW 11 110,135,121 (GRCm39) missense probably benign 0.00
R5484:Abca6 UTSW 11 110,074,899 (GRCm39) missense probably damaging 1.00
R5498:Abca6 UTSW 11 110,099,670 (GRCm39) missense possibly damaging 0.95
R5645:Abca6 UTSW 11 110,141,234 (GRCm39) missense probably damaging 0.99
R5680:Abca6 UTSW 11 110,127,471 (GRCm39) missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110,100,927 (GRCm39) missense probably damaging 1.00
R5779:Abca6 UTSW 11 110,075,496 (GRCm39) missense probably benign 0.37
R5818:Abca6 UTSW 11 110,110,469 (GRCm39) missense probably damaging 1.00
R6282:Abca6 UTSW 11 110,099,650 (GRCm39) missense probably damaging 0.98
R6455:Abca6 UTSW 11 110,132,407 (GRCm39) missense probably damaging 1.00
R6826:Abca6 UTSW 11 110,107,431 (GRCm39) missense probably benign 0.15
R6857:Abca6 UTSW 11 110,110,514 (GRCm39) missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110,081,064 (GRCm39) missense probably benign
R6931:Abca6 UTSW 11 110,135,154 (GRCm39) missense probably benign 0.27
R7222:Abca6 UTSW 11 110,082,519 (GRCm39) missense probably benign 0.29
R7242:Abca6 UTSW 11 110,132,479 (GRCm39) missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110,073,852 (GRCm39) critical splice donor site probably null
R7387:Abca6 UTSW 11 110,093,246 (GRCm39) missense probably benign
R7420:Abca6 UTSW 11 110,141,303 (GRCm39) missense probably benign 0.24
R7494:Abca6 UTSW 11 110,099,571 (GRCm39) missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110,071,084 (GRCm39) missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110,109,778 (GRCm39) missense probably benign 0.00
R7674:Abca6 UTSW 11 110,110,123 (GRCm39) missense probably damaging 1.00
R7753:Abca6 UTSW 11 110,074,933 (GRCm39) missense probably damaging 1.00
R7800:Abca6 UTSW 11 110,078,698 (GRCm39) missense probably benign 0.00
R7842:Abca6 UTSW 11 110,087,523 (GRCm39) missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110,082,454 (GRCm39) missense probably benign 0.01
R8119:Abca6 UTSW 11 110,087,930 (GRCm39) missense probably benign 0.00
R8139:Abca6 UTSW 11 110,074,959 (GRCm39) missense probably damaging 1.00
R8176:Abca6 UTSW 11 110,135,020 (GRCm39) missense probably benign 0.01
R8179:Abca6 UTSW 11 110,136,100 (GRCm39) missense probably damaging 1.00
R8197:Abca6 UTSW 11 110,102,641 (GRCm39) missense probably damaging 0.99
R8241:Abca6 UTSW 11 110,079,456 (GRCm39) missense probably null 1.00
R8404:Abca6 UTSW 11 110,110,145 (GRCm39) missense probably damaging 0.99
R8429:Abca6 UTSW 11 110,093,208 (GRCm39) missense probably benign
R8502:Abca6 UTSW 11 110,110,145 (GRCm39) missense probably damaging 0.99
R8816:Abca6 UTSW 11 110,127,513 (GRCm39) missense probably benign 0.04
R8964:Abca6 UTSW 11 110,139,363 (GRCm39) missense probably benign 0.00
R9153:Abca6 UTSW 11 110,107,481 (GRCm39) missense possibly damaging 0.61
R9233:Abca6 UTSW 11 110,082,496 (GRCm39) missense probably benign 0.31
R9407:Abca6 UTSW 11 110,093,210 (GRCm39) nonsense probably null
R9412:Abca6 UTSW 11 110,103,059 (GRCm39) missense probably damaging 0.99
R9453:Abca6 UTSW 11 110,138,090 (GRCm39) critical splice donor site probably null
R9533:Abca6 UTSW 11 110,102,582 (GRCm39) missense probably benign 0.16
R9546:Abca6 UTSW 11 110,135,042 (GRCm39) nonsense probably null
R9650:Abca6 UTSW 11 110,071,446 (GRCm39) missense probably benign 0.32
R9702:Abca6 UTSW 11 110,107,378 (GRCm39) missense probably damaging 1.00
R9709:Abca6 UTSW 11 110,102,589 (GRCm39) missense probably benign 0.01
X0024:Abca6 UTSW 11 110,135,081 (GRCm39) missense probably benign 0.02
X0064:Abca6 UTSW 11 110,087,968 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCTGGTGTACCACTATTAAAGC -3'
(R):5'- CATGGTCATGCCTCACAGAG -3'

Sequencing Primer
(F):5'- GGGACCAGAGTTTCATTCCCAGTAC -3'
(R):5'- CACAGAGCGTGGCTTTGGAATTC -3'
Posted On 2016-10-05