Mutagenetix > Incidental Mutation

Incidental Mutation 'R5503:2700049A03Rik'

430760

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3

MMRRC Submission

043064-MU

Accession Numbers

Genbank: NM_001163378, NM_029818

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

71136848-71243303 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 71164546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 685 (E685*)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

AlphaFold

E9PV87

Predicted Effect

probably null
Transcript: ENSMUST00000045907
AA Change: E685*

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: E685*

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000149564
AA Change: E685*

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: E685*

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71167119	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71194468	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71164378	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71167181	nonsense	probably null
IGL01835:2700049A03Rik	APN	12	71167183	missense	probably benign	0.00
IGL02122:2700049A03Rik	APN	12	71170525	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71148260	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71154856	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71193373	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71140883	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71158825	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71137909	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71160386	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71170666	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71177918	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71167150	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71148420	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71138030	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71193310	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71164388	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71177868	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71158883	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71219308	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71216144	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71170587	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71150259	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71219221	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71150244	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71160412	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71188619	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2337:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2512:2700049A03Rik	UTSW	12	71173171	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71154756	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3236:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3808:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71148263	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4651:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4735:2700049A03Rik	UTSW	12	71216123	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71189442	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4852:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71189646	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71243025	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71193349	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71188791	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71243027	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5502:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5671:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5725:2700049A03Rik	UTSW	12	71193319	missense	probably benign	0.05
R5956:2700049A03Rik	UTSW	12	71157119	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71184530	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71187426	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71170636	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71164544	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71216230	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71216057	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71219189	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71140906	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71189574	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71150405	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71164406	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71173129	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71142121	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71138041	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71189582	missense	possibly damaging	0.71
R8852:2700049A03Rik	UTSW	12	71184423	missense	possibly damaging	0.93
R8860:2700049A03Rik	UTSW	12	71184423	missense	possibly damaging	0.93
R9039:2700049A03Rik	UTSW	12	71167075	missense	possibly damaging	0.51
R9281:2700049A03Rik	UTSW	12	71158913	missense	possibly damaging	0.51
R9308:2700049A03Rik	UTSW	12	71184459	missense	probably benign	0.23
R9385:2700049A03Rik	UTSW	12	71161192	missense	possibly damaging	0.52
R9412:2700049A03Rik	UTSW	12	71188683	missense	possibly damaging	0.71
R9643:2700049A03Rik	UTSW	12	71164415	missense	possibly damaging	0.92
R9676:2700049A03Rik	UTSW	12	71161131	missense	possibly damaging	0.86
R9776:2700049A03Rik	UTSW	12	71188674	missense	possibly damaging	0.71
R9789:2700049A03Rik	UTSW	12	71184583	missense	probably benign
Z1177:2700049A03Rik	UTSW	12	71164484	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACCTTTTATGTTTCCTAGGTGG -3'
(R):5'- TGTTCCCTGGCAGATAACGG -3'

Sequencing Primer
(F):5'- AACATGTTTTGCATTGGTAGGGCC -3'
(R):5'- TAACGGTACTGAAGCTCTGC -3'

Posted On

2016-10-05