Incidental Mutation 'R5503:Dapk1'
ID 430766
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Name death associated protein kinase 1
Synonyms DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 60749761-60911005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60873126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 343 (F343L)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
AlphaFold Q80YE7
Predicted Effect probably benign
Transcript: ENSMUST00000044083
AA Change: F343L

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: F343L

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077453
AA Change: F343L

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: F343L

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224340
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect probably benign
Transcript: ENSMUST00000226059
AA Change: F343L

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1126 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cdh18 A G 15: 23,436,620 (GRCm39) Y492C probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60,908,854 (GRCm39) missense probably benign 0.23
IGL00500:Dapk1 APN 13 60,908,618 (GRCm39) missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60,909,062 (GRCm39) missense probably benign 0.00
IGL00903:Dapk1 APN 13 60,909,211 (GRCm39) missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60,908,612 (GRCm39) missense probably benign
IGL01535:Dapk1 APN 13 60,878,845 (GRCm39) splice site probably benign
IGL01755:Dapk1 APN 13 60,908,990 (GRCm39) missense possibly damaging 0.63
IGL01755:Dapk1 APN 13 60,908,989 (GRCm39) missense probably damaging 0.97
IGL01862:Dapk1 APN 13 60,874,424 (GRCm39) missense probably benign 0.39
IGL01985:Dapk1 APN 13 60,884,074 (GRCm39) missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60,878,696 (GRCm39) missense probably benign
IGL02376:Dapk1 APN 13 60,844,208 (GRCm39) missense probably benign 0.00
IGL02449:Dapk1 APN 13 60,867,584 (GRCm39) splice site probably benign
IGL02490:Dapk1 APN 13 60,897,148 (GRCm39) missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60,909,621 (GRCm39) nonsense probably null
IGL02516:Dapk1 APN 13 60,844,161 (GRCm39) missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60,899,031 (GRCm39) missense probably benign
IGL02604:Dapk1 APN 13 60,896,134 (GRCm39) missense probably benign
IGL03035:Dapk1 APN 13 60,864,587 (GRCm39) missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60,909,126 (GRCm39) missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60,865,963 (GRCm39) splice site probably benign
R0116:Dapk1 UTSW 13 60,908,914 (GRCm39) missense probably benign
R0165:Dapk1 UTSW 13 60,909,407 (GRCm39) missense probably benign 0.39
R0357:Dapk1 UTSW 13 60,877,372 (GRCm39) nonsense probably null
R0446:Dapk1 UTSW 13 60,873,101 (GRCm39) splice site probably null
R0502:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0503:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0597:Dapk1 UTSW 13 60,909,198 (GRCm39) missense probably benign 0.40
R0614:Dapk1 UTSW 13 60,865,946 (GRCm39) missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60,905,262 (GRCm39) missense probably benign 0.14
R1023:Dapk1 UTSW 13 60,878,799 (GRCm39) missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60,869,679 (GRCm39) critical splice donor site probably null
R1101:Dapk1 UTSW 13 60,864,599 (GRCm39) missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60,901,957 (GRCm39) missense probably benign 0.28
R1630:Dapk1 UTSW 13 60,877,345 (GRCm39) missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60,866,278 (GRCm39) critical splice donor site probably null
R1799:Dapk1 UTSW 13 60,867,468 (GRCm39) missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60,869,671 (GRCm39) missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60,899,022 (GRCm39) missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60,909,481 (GRCm39) missense possibly damaging 0.80
R2131:Dapk1 UTSW 13 60,877,345 (GRCm39) missense possibly damaging 0.91
R2154:Dapk1 UTSW 13 60,877,317 (GRCm39) missense probably benign 0.36
R2288:Dapk1 UTSW 13 60,909,563 (GRCm39) missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60,905,167 (GRCm39) missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60,878,745 (GRCm39) missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60,900,030 (GRCm39) missense probably benign 0.34
R2909:Dapk1 UTSW 13 60,864,631 (GRCm39) critical splice donor site probably null
R2926:Dapk1 UTSW 13 60,867,564 (GRCm39) missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60,896,014 (GRCm39) missense probably benign 0.09
R3810:Dapk1 UTSW 13 60,908,503 (GRCm39) missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4375:Dapk1 UTSW 13 60,909,403 (GRCm39) missense probably benign
R4377:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4490:Dapk1 UTSW 13 60,865,942 (GRCm39) missense probably benign 0.26
R4576:Dapk1 UTSW 13 60,869,636 (GRCm39) missense probably benign 0.13
R4599:Dapk1 UTSW 13 60,865,861 (GRCm39) missense probably benign 0.22
R4682:Dapk1 UTSW 13 60,898,961 (GRCm39) missense probably benign 0.41
R4717:Dapk1 UTSW 13 60,874,476 (GRCm39) critical splice donor site probably null
R4775:Dapk1 UTSW 13 60,897,156 (GRCm39) missense probably benign 0.02
R4790:Dapk1 UTSW 13 60,870,919 (GRCm39) frame shift probably null
R4897:Dapk1 UTSW 13 60,909,600 (GRCm39) missense probably benign 0.01
R4931:Dapk1 UTSW 13 60,908,774 (GRCm39) missense probably benign 0.04
R5113:Dapk1 UTSW 13 60,869,592 (GRCm39) missense probably benign 0.01
R5948:Dapk1 UTSW 13 60,877,209 (GRCm39) missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60,909,476 (GRCm39) missense probably benign 0.00
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60,909,580 (GRCm39) missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60,909,140 (GRCm39) missense probably benign 0.01
R6331:Dapk1 UTSW 13 60,877,256 (GRCm39) nonsense probably null
R6553:Dapk1 UTSW 13 60,908,975 (GRCm39) missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60,909,161 (GRCm39) missense probably benign 0.03
R6602:Dapk1 UTSW 13 60,897,018 (GRCm39) missense probably benign 0.20
R6640:Dapk1 UTSW 13 60,864,628 (GRCm39) missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60,908,708 (GRCm39) missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60,873,154 (GRCm39) missense probably benign 0.22
R6799:Dapk1 UTSW 13 60,900,049 (GRCm39) missense probably benign
R6809:Dapk1 UTSW 13 60,899,103 (GRCm39) missense probably benign 0.00
R6915:Dapk1 UTSW 13 60,844,256 (GRCm39) missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60,884,138 (GRCm39) missense probably benign 0.11
R6979:Dapk1 UTSW 13 60,896,095 (GRCm39) missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60,844,209 (GRCm39) missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60,909,599 (GRCm39) missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60,902,024 (GRCm39) missense probably benign 0.02
R7203:Dapk1 UTSW 13 60,844,149 (GRCm39) missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60,867,455 (GRCm39) missense probably benign 0.00
R7448:Dapk1 UTSW 13 60,898,990 (GRCm39) missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60,905,311 (GRCm39) missense probably benign 0.18
R7532:Dapk1 UTSW 13 60,878,700 (GRCm39) missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60,908,987 (GRCm39) missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60,909,365 (GRCm39) missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60,899,007 (GRCm39) missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60,873,153 (GRCm39) missense probably benign 0.41
R7822:Dapk1 UTSW 13 60,873,715 (GRCm39) missense probably benign 0.05
R7973:Dapk1 UTSW 13 60,909,377 (GRCm39) missense probably damaging 1.00
R8103:Dapk1 UTSW 13 60,897,009 (GRCm39) missense probably damaging 0.98
R8121:Dapk1 UTSW 13 60,909,212 (GRCm39) missense probably damaging 0.99
R8245:Dapk1 UTSW 13 60,878,710 (GRCm39) missense probably benign
R8401:Dapk1 UTSW 13 60,870,904 (GRCm39) missense probably benign 0.01
R8419:Dapk1 UTSW 13 60,887,911 (GRCm39) missense probably benign 0.00
R8926:Dapk1 UTSW 13 60,908,734 (GRCm39) missense probably damaging 0.98
R9063:Dapk1 UTSW 13 60,866,264 (GRCm39) missense probably benign 0.06
R9131:Dapk1 UTSW 13 60,909,208 (GRCm39) missense probably damaging 1.00
R9176:Dapk1 UTSW 13 60,866,262 (GRCm39) missense probably damaging 1.00
R9301:Dapk1 UTSW 13 60,866,125 (GRCm39) missense possibly damaging 0.92
R9407:Dapk1 UTSW 13 60,898,991 (GRCm39) nonsense probably null
R9491:Dapk1 UTSW 13 60,877,369 (GRCm39) missense probably benign 0.44
R9510:Dapk1 UTSW 13 60,910,203 (GRCm39) missense unknown
R9624:Dapk1 UTSW 13 60,895,937 (GRCm39) missense probably benign 0.31
R9726:Dapk1 UTSW 13 60,898,948 (GRCm39) missense probably benign 0.25
R9794:Dapk1 UTSW 13 60,909,082 (GRCm39) missense probably damaging 0.98
Z1176:Dapk1 UTSW 13 60,908,618 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCAATGCGGATGACATCAGG -3'
(R):5'- CAAGGTATGGTTGGGGTCACAG -3'

Sequencing Primer
(F):5'- TGAAAGGGTACAGGTTCACCTCC -3'
(R):5'- TTGGGGTCACAGTCTATGAAAC -3'
Posted On 2016-10-05