Incidental Mutation 'R5503:Col4a3bp'
ID 430768
Institutional Source Beutler Lab
Gene Symbol Col4a3bp
Ensembl Gene ENSMUSG00000021669
Gene Name collagen, type IV, alpha 3 (Goodpasture antigen) binding protein
Synonyms GPBP, 2810404O15Rik, Cert, ceramide transport protein, 9230101K08Rik
MMRRC Submission 043064-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5503 (G1)
Quality Score 95
Status Validated
Chromosome 13
Chromosomal Location 96542618-96640167 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 96543239 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 26 (R26C)
Ref Sequence ENSEMBL: ENSMUSP00000136766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000077672] [ENSMUST00000109444] [ENSMUST00000179226] [ENSMUST00000223475]
AlphaFold Q9EQG9
Predicted Effect probably benign
Transcript: ENSMUST00000022172
SMART Domains Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668

DomainStartEndE-ValueType
Pfam:IMS 105 324 1.7e-47 PFAM
Pfam:IMS_C 406 525 5.5e-22 PFAM
PDB:2LSJ|B 559 582 9e-8 PDB
ZnF_Rad18 619 645 2.89e-9 SMART
ZnF_Rad18 761 787 2.31e-8 SMART
low complexity region 828 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077672
AA Change: R26C

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000076856
Gene: ENSMUSG00000021669
AA Change: R26C

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 398 619 1.15e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109444
AA Change: R26C

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105070
Gene: ENSMUSG00000021669
AA Change: R26C

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000179226
AA Change: R26C

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000136766
Gene: ENSMUSG00000021669
AA Change: R26C

DomainStartEndE-ValueType
PH 24 119 4.52e-21 SMART
low complexity region 138 150 N/A INTRINSIC
coiled coil region 273 301 N/A INTRINSIC
START 372 593 1.15e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222434
Predicted Effect probably benign
Transcript: ENSMUST00000223475
Meta Mutation Damage Score 0.4301 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display embryonic lethality during organogenesis with reduced embryo size, impaired heart function, abnormal heart morphology, abnormal mitochondrial morphology and physiology, abnormal endoplasmic reticulum morphology, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Col4a3bp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Col4a3bp APN 13 96614802 missense probably damaging 0.99
IGL02121:Col4a3bp APN 13 96599474 missense probably benign 0.45
IGL02207:Col4a3bp APN 13 96624792 critical splice donor site probably null
IGL02285:Col4a3bp APN 13 96616482 missense probably benign 0.10
IGL02425:Col4a3bp APN 13 96609882 missense probably damaging 1.00
IGL02749:Col4a3bp APN 13 96629135 missense possibly damaging 0.60
IGL03288:Col4a3bp APN 13 96634192 missense probably benign 0.00
PIT4508001:Col4a3bp UTSW 13 96630776 missense probably damaging 1.00
R0197:Col4a3bp UTSW 13 96549287 missense probably benign 0.05
R0317:Col4a3bp UTSW 13 96634121 nonsense probably null
R2103:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R2104:Col4a3bp UTSW 13 96634886 missense probably damaging 1.00
R4664:Col4a3bp UTSW 13 96599457 missense probably benign 0.01
R4782:Col4a3bp UTSW 13 96612265 missense probably benign
R4824:Col4a3bp UTSW 13 96616487 missense probably benign
R5060:Col4a3bp UTSW 13 96603155 missense probably benign 0.37
R5131:Col4a3bp UTSW 13 96614835 missense probably damaging 1.00
R5385:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.94
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R6034:Col4a3bp UTSW 13 96609800 missense probably benign 0.06
R7193:Col4a3bp UTSW 13 96630833 critical splice donor site probably null
R7819:Col4a3bp UTSW 13 96629067 missense possibly damaging 0.74
R7827:Col4a3bp UTSW 13 96617055 missense probably damaging 1.00
R8147:Col4a3bp UTSW 13 96543228 missense probably benign
R8228:Col4a3bp UTSW 13 96543215 missense probably benign 0.08
R8486:Col4a3bp UTSW 13 96634182 missense probably damaging 0.99
R9039:Col4a3bp UTSW 13 96543209 missense probably benign 0.02
R9141:Col4a3bp UTSW 13 96617060 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGAAGGGCAGGCTTTCTTC -3'
(R):5'- AGCTGACAGGATCCAGGAATTG -3'

Sequencing Primer
(F):5'- GTTCCCTCACTCCCCGGAG -3'
(R):5'- TGGCCAGGCACTCATTCCAAG -3'
Posted On 2016-10-05