Mutagenetix > Incidental Mutations

Incidental Mutation 'R5503:Col4a3bp'

430768

Institutional Source

Beutler Lab

Gene Symbol

Col4a3bp

Ensembl Gene

ENSMUSG00000021669

Gene Name

collagen, type IV, alpha 3 (Goodpasture antigen) binding protein

Synonyms

GPBP, 2810404O15Rik, Cert, ceramide transport protein, 9230101K08Rik

MMRRC Submission

043064-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5503 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

96542618-96640167 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 96543239 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 26 (R26C)

Ref Sequence

ENSEMBL: ENSMUSP00000136766 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022172] [ENSMUST00000077672] [ENSMUST00000109444] [ENSMUST00000179226] [ENSMUST00000223475]

Predicted Effect

probably benign
Transcript: ENSMUST00000022172

SMART Domains

Protein: ENSMUSP00000022172
Gene: ENSMUSG00000021668

Domain	Start	End	E-Value	Type
Pfam:IMS	105	324	1.7e-47	PFAM
Pfam:IMS_C	406	525	5.5e-22	PFAM
PDB:2LSJ\|B	559	582	9e-8	PDB
ZnF_Rad18	619	645	2.89e-9	SMART
ZnF_Rad18	761	787	2.31e-8	SMART
low complexity region	828	839	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077672
AA Change: R26C

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000076856
Gene: ENSMUSG00000021669
AA Change: R26C

Domain	Start	End	E-Value	Type
PH	24	119	4.52e-21	SMART
low complexity region	138	150	N/A	INTRINSIC
coiled coil region	273	301	N/A	INTRINSIC
START	398	619	1.15e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109444
AA Change: R26C

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105070
Gene: ENSMUSG00000021669
AA Change: R26C

Domain	Start	End	E-Value	Type
PH	24	119	4.52e-21	SMART
low complexity region	138	150	N/A	INTRINSIC
coiled coil region	273	301	N/A	INTRINSIC
START	372	593	1.15e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000179226
AA Change: R26C

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000136766
Gene: ENSMUSG00000021669
AA Change: R26C

Domain	Start	End	E-Value	Type
PH	24	119	4.52e-21	SMART
low complexity region	138	150	N/A	INTRINSIC
coiled coil region	273	301	N/A	INTRINSIC
START	372	593	1.15e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220785

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222100

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222434

Predicted Effect

probably benign
Transcript: ENSMUST00000223475

Meta Mutation Damage Score

0.4301

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display embryonic lethality during organogenesis with reduced embryo size, impaired heart function, abnormal heart morphology, abnormal mitochondrial morphology and physiology, abnormal endoplasmic reticulum morphology, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Col4a3bp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:Col4a3bp	APN	13	96614802	missense	probably damaging	0.99
IGL02121:Col4a3bp	APN	13	96599474	missense	probably benign	0.45
IGL02207:Col4a3bp	APN	13	96624792	critical splice donor site	probably null
IGL02285:Col4a3bp	APN	13	96616482	missense	probably benign	0.10
IGL02425:Col4a3bp	APN	13	96609882	missense	probably damaging	1.00
IGL02749:Col4a3bp	APN	13	96629135	missense	possibly damaging	0.60
IGL03288:Col4a3bp	APN	13	96634192	missense	probably benign	0.00
PIT4508001:Col4a3bp	UTSW	13	96630776	missense	probably damaging	1.00
R0197:Col4a3bp	UTSW	13	96549287	missense	probably benign	0.05
R0317:Col4a3bp	UTSW	13	96634121	nonsense	probably null
R2103:Col4a3bp	UTSW	13	96634886	missense	probably damaging	1.00
R2104:Col4a3bp	UTSW	13	96634886	missense	probably damaging	1.00
R4664:Col4a3bp	UTSW	13	96599457	missense	probably benign	0.01
R4782:Col4a3bp	UTSW	13	96612265	missense	probably benign
R4824:Col4a3bp	UTSW	13	96616487	missense	probably benign
R5060:Col4a3bp	UTSW	13	96603155	missense	probably benign	0.37
R5131:Col4a3bp	UTSW	13	96614835	missense	probably damaging	1.00
R5385:Col4a3bp	UTSW	13	96629067	missense	possibly damaging	0.94
R6034:Col4a3bp	UTSW	13	96609800	missense	probably benign	0.06
R6034:Col4a3bp	UTSW	13	96609800	missense	probably benign	0.06
R7193:Col4a3bp	UTSW	13	96630833	critical splice donor site	probably null
R7819:Col4a3bp	UTSW	13	96629067	missense	possibly damaging	0.74
R7827:Col4a3bp	UTSW	13	96617055	missense	probably damaging	1.00
R8147:Col4a3bp	UTSW	13	96543228	missense	probably benign
R8228:Col4a3bp	UTSW	13	96543215	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- TGGAAGGGCAGGCTTTCTTC -3'
(R):5'- AGCTGACAGGATCCAGGAATTG -3'

Sequencing Primer
(F):5'- GTTCCCTCACTCCCCGGAG -3'
(R):5'- TGGCCAGGCACTCATTCCAAG -3'

Posted On

2016-10-05