Incidental Mutation 'R5503:Cdh18'
ID430771
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission 043064-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5503 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23436534 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 492 (Y492C)
Ref Sequence ENSEMBL: ENSMUSP00000153905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040427
Predicted Effect possibly damaging
Transcript: ENSMUST00000164787
AA Change: Y492C

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: Y492C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165614
AA Change: Y492C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: Y492C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226693
AA Change: Y492C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6915 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACGGCATTCAGAGCTAG -3'
(R):5'- GGGGAAAATTCATTTTGTAGGATGC -3'

Sequencing Primer
(F):5'- CATTCAGAGCTAGAGGCAAGC -3'
(R):5'- AATTCATTTTGTAGGATGCTCAAAAG -3'
Posted On2016-10-05