Incidental Mutation 'R5503:Cdh18'
ID 430771
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Name cadherin 18
Synonyms B230220E17Rik
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.112) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 22549108-23474504 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23436620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 492 (Y492C)
Ref Sequence ENSEMBL: ENSMUSP00000153905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
AlphaFold E9Q9Q6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000040427
Predicted Effect possibly damaging
Transcript: ENSMUST00000164787
AA Change: Y492C

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: Y492C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165614
AA Change: Y492C

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: Y492C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167623
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226693
AA Change: Y492C

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.6915 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
Abca6 A G 11: 110,109,083 (GRCm39) S696P probably damaging Het
Abca9 G A 11: 110,032,436 (GRCm39) T727M probably damaging Het
Alpk2 T C 18: 65,439,312 (GRCm39) R1161G probably benign Het
Amy1 T C 3: 113,349,709 (GRCm39) D487G probably benign Het
Arap2 G A 5: 62,787,529 (GRCm39) A1409V probably damaging Het
B4galt6 C A 18: 20,878,409 (GRCm39) probably null Het
Cacna1s G A 1: 136,014,480 (GRCm39) G382D probably damaging Het
Camk2a A G 18: 61,111,072 (GRCm39) D87G probably damaging Het
Cert1 C T 13: 96,679,747 (GRCm39) R26C possibly damaging Het
Col18a1 C T 10: 76,907,454 (GRCm39) G861D probably damaging Het
Crybg1 C A 10: 43,874,762 (GRCm39) S782I probably benign Het
Csgalnact1 G A 8: 68,914,125 (GRCm39) L27F probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dapk1 T C 13: 60,873,126 (GRCm39) F343L probably benign Het
Dgat1 A T 15: 76,386,394 (GRCm39) probably benign Het
Dnah11 C A 12: 117,844,186 (GRCm39) probably null Het
Dsg2 T A 18: 20,713,708 (GRCm39) Y226* probably null Het
Epg5 T A 18: 77,994,422 (GRCm39) M351K possibly damaging Het
F13b A G 1: 139,450,281 (GRCm39) T648A probably benign Het
Fgf17 T C 14: 70,874,408 (GRCm39) Y127C probably damaging Het
Fkbp15 G A 4: 62,246,124 (GRCm39) P435S probably benign Het
Gfm1 G A 3: 67,361,060 (GRCm39) probably null Het
Gigyf1 T C 5: 137,521,729 (GRCm39) probably benign Het
Gm12830 A T 4: 114,678,936 (GRCm39) T6S unknown Het
Gm6465 A T 5: 11,898,150 (GRCm39) N88I probably damaging Het
Gpr18 C T 14: 122,149,159 (GRCm39) V289I probably damaging Het
Ipp G T 4: 116,395,135 (GRCm39) E557* probably null Het
Klhl12 T A 1: 134,413,653 (GRCm39) probably null Het
Klhl38 A G 15: 58,185,745 (GRCm39) V328A possibly damaging Het
Kndc1 A G 7: 139,511,802 (GRCm39) T1470A probably damaging Het
Kntc1 T A 5: 123,957,939 (GRCm39) D2173E possibly damaging Het
Lipi T C 16: 75,370,864 (GRCm39) K118E probably benign Het
Marf1 A C 16: 13,970,095 (GRCm39) L208R probably damaging Het
Misp G A 10: 79,662,552 (GRCm39) R323K probably damaging Het
Mlxip T A 5: 123,533,390 (GRCm39) M133K probably damaging Het
Mon2 A T 10: 122,868,550 (GRCm39) M501K possibly damaging Het
Myh2 A G 11: 67,064,275 (GRCm39) I77V probably benign Het
Napa C A 7: 15,849,549 (GRCm39) Q254K probably benign Het
Nckap5l C A 15: 99,323,503 (GRCm39) G1000V probably damaging Het
Neo1 A T 9: 58,892,933 (GRCm39) S236R possibly damaging Het
Neurl4 T A 11: 69,797,194 (GRCm39) Y594N probably damaging Het
Nmral1 G A 16: 4,533,493 (GRCm39) P94L probably benign Het
Notch3 A T 17: 32,366,029 (GRCm39) I1024N probably benign Het
Nsd1 T A 13: 55,393,752 (GRCm39) I451K probably damaging Het
Nt5c3b T C 11: 100,323,883 (GRCm39) D143G probably benign Het
Oplah A G 15: 76,189,646 (GRCm39) probably null Het
Or13a17 A C 7: 140,271,309 (GRCm39) M164L probably benign Het
Or2ak4 T A 11: 58,649,154 (GRCm39) V221E probably damaging Het
Or6b2b C A 1: 92,418,918 (GRCm39) K186N probably benign Het
Or7d10 A G 9: 19,831,675 (GRCm39) T57A probably benign Het
Or8b48 T C 9: 38,493,368 (GRCm39) V265A probably benign Het
Or8g19 A G 9: 39,055,780 (GRCm39) N128S probably benign Het
Phb2 T A 6: 124,689,985 (GRCm39) probably benign Het
Plcl2 A G 17: 50,816,957 (GRCm39) I108V probably benign Het
Plpp6 T A 19: 28,942,146 (GRCm39) M249K probably damaging Het
Pnpt1 G A 11: 29,088,156 (GRCm39) G189E probably damaging Het
Pramel17 A T 4: 101,692,999 (GRCm39) Y334N probably benign Het
Ptprn C T 1: 75,228,519 (GRCm39) V853M probably damaging Het
Ptprq T C 10: 107,524,189 (GRCm39) probably null Het
Rai1 G A 11: 60,077,279 (GRCm39) V448I probably benign Het
Rbm20 T A 19: 53,839,785 (GRCm39) C925S possibly damaging Het
Rin3 C A 12: 102,279,314 (GRCm39) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,324,505 (GRCm39) noncoding transcript Het
Rpl39-ps A T 15: 102,543,561 (GRCm39) noncoding transcript Het
Rtn4ip1 T A 10: 43,783,879 (GRCm39) D133E probably benign Het
Ryr1 T C 7: 28,768,453 (GRCm39) K2839E possibly damaging Het
Septin5 T C 16: 18,442,118 (GRCm39) K268R probably benign Het
Serpinb6b T A 13: 33,161,642 (GRCm39) D238E possibly damaging Het
Slc15a2 C T 16: 36,582,747 (GRCm39) V214M probably damaging Het
Smarca2 T C 19: 26,601,336 (GRCm39) M18T probably damaging Het
Smarca2 C A 19: 26,659,446 (GRCm39) T912K possibly damaging Het
Smdt1 A T 15: 82,232,101 (GRCm39) R46S possibly damaging Het
Spa17 A C 9: 37,523,273 (GRCm39) F5V probably damaging Het
Spag17 A G 3: 99,934,560 (GRCm39) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,237,471 (GRCm39) probably benign Het
Tlr1 A T 5: 65,083,635 (GRCm39) V314D probably damaging Het
Trappc8 A T 18: 20,969,957 (GRCm39) L1011Q probably benign Het
Tsga10 A G 1: 37,800,028 (GRCm39) *691Q probably null Het
Vav1 A T 17: 57,610,079 (GRCm39) K420* probably null Het
Vmn1r174 C G 7: 23,453,562 (GRCm39) T76R probably benign Het
Vmn2r116 A G 17: 23,605,778 (GRCm39) E230G probably benign Het
Vps13b A G 15: 35,452,312 (GRCm39) T637A probably damaging Het
Zbtb7a A G 10: 80,980,631 (GRCm39) E275G probably damaging Het
Zfp280b A G 10: 75,875,296 (GRCm39) probably null Het
Zfp763 A G 17: 33,238,507 (GRCm39) Y213H possibly damaging Het
Zfp78 T A 7: 6,381,528 (GRCm39) W161R probably benign Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23,173,882 (GRCm39) missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23,446,077 (GRCm39) missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23,474,269 (GRCm39) missense probably benign 0.20
IGL02192:Cdh18 APN 15 23,460,402 (GRCm39) missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23,173,875 (GRCm39) missense probably benign 0.00
IGL02717:Cdh18 APN 15 23,410,801 (GRCm39) nonsense probably null
IGL03241:Cdh18 APN 15 23,227,019 (GRCm39) missense probably benign 0.19
IGL03268:Cdh18 APN 15 23,366,953 (GRCm39) missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23,226,872 (GRCm39) missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23,366,999 (GRCm39) missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23,366,971 (GRCm39) missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23,410,876 (GRCm39) missense probably benign 0.01
R0761:Cdh18 UTSW 15 23,226,838 (GRCm39) missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23,474,081 (GRCm39) missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23,474,403 (GRCm39) missense probably benign 0.00
R1550:Cdh18 UTSW 15 23,436,634 (GRCm39) missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23,474,485 (GRCm39) missense probably benign 0.38
R1682:Cdh18 UTSW 15 23,400,671 (GRCm39) missense probably benign 0.05
R1770:Cdh18 UTSW 15 23,474,487 (GRCm39) missense probably benign
R1829:Cdh18 UTSW 15 23,173,938 (GRCm39) missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23,410,891 (GRCm39) missense probably benign 0.00
R2435:Cdh18 UTSW 15 23,367,094 (GRCm39) missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23,410,771 (GRCm39) missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23,474,187 (GRCm39) missense probably benign
R4002:Cdh18 UTSW 15 23,383,048 (GRCm39) missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22,714,637 (GRCm39) intron probably benign
R4581:Cdh18 UTSW 15 23,226,869 (GRCm39) missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23,474,454 (GRCm39) missense probably benign 0.05
R4625:Cdh18 UTSW 15 22,714,128 (GRCm39) intron probably benign
R4786:Cdh18 UTSW 15 23,410,873 (GRCm39) missense probably null 1.00
R4811:Cdh18 UTSW 15 23,226,877 (GRCm39) missense probably benign 0.30
R5023:Cdh18 UTSW 15 23,259,752 (GRCm39) missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22,714,625 (GRCm39) intron probably benign
R5278:Cdh18 UTSW 15 23,474,244 (GRCm39) missense probably benign 0.04
R5416:Cdh18 UTSW 15 23,226,809 (GRCm39) missense probably damaging 1.00
R5617:Cdh18 UTSW 15 23,226,854 (GRCm39) missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23,474,302 (GRCm39) missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23,227,022 (GRCm39) missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23,227,022 (GRCm39) missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23,436,620 (GRCm39) missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23,474,191 (GRCm39) missense probably benign
R6718:Cdh18 UTSW 15 23,226,835 (GRCm39) missense probably benign 0.15
R6796:Cdh18 UTSW 15 23,446,159 (GRCm39) missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23,227,036 (GRCm39) missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23,366,942 (GRCm39) missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23,410,811 (GRCm39) missense probably benign
R7516:Cdh18 UTSW 15 23,259,684 (GRCm39) splice site probably null
R7519:Cdh18 UTSW 15 23,474,298 (GRCm39) missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23,400,683 (GRCm39) nonsense probably null
R7618:Cdh18 UTSW 15 23,367,056 (GRCm39) missense probably damaging 1.00
R7844:Cdh18 UTSW 15 23,410,873 (GRCm39) missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23,474,413 (GRCm39) missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23,446,073 (GRCm39) missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23,474,138 (GRCm39) missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23,226,770 (GRCm39) missense probably damaging 1.00
R8916:Cdh18 UTSW 15 23,410,813 (GRCm39) missense probably damaging 0.99
R9093:Cdh18 UTSW 15 23,474,064 (GRCm39) missense probably damaging 1.00
R9183:Cdh18 UTSW 15 23,227,065 (GRCm39) critical splice donor site probably null
R9399:Cdh18 UTSW 15 23,173,899 (GRCm39) missense probably damaging 1.00
R9531:Cdh18 UTSW 15 23,436,562 (GRCm39) missense probably benign
Z1189:Cdh18 UTSW 15 23,474,369 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCTACGGCATTCAGAGCTAG -3'
(R):5'- GGGGAAAATTCATTTTGTAGGATGC -3'

Sequencing Primer
(F):5'- CATTCAGAGCTAGAGGCAAGC -3'
(R):5'- AATTCATTTTGTAGGATGCTCAAAAG -3'
Posted On 2016-10-05