Incidental Mutation 'R5503:Sept5'
ID 430778
Institutional Source Beutler Lab
Gene Symbol Sept5
Ensembl Gene ENSMUSG00000072214
Gene Name septin 5
Synonyms Cdcrel1, Pnutl1
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 18620502-18629954 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18623368 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 268 (K268R)
Ref Sequence ENSEMBL: ENSMUSP00000156292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000231956] [ENSMUST00000232653]
AlphaFold Q9Z2Q6
Predicted Effect probably benign
Transcript: ENSMUST00000051160
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096987
AA Change: K256R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214
AA Change: K256R

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167388
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect probably benign
Transcript: ENSMUST00000231335
AA Change: K265R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Predicted Effect probably benign
Transcript: ENSMUST00000231622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect probably benign
Transcript: ENSMUST00000231956
AA Change: K268R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Predicted Effect probably benign
Transcript: ENSMUST00000232653
AA Change: K265R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene show no gross phenotypic changes. Partial defects in synaptic transmission is reported for one allele, and platelet secretion and modest behavioral defects reported for a different allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 (GRCm38) E685* probably null Het
2700049A03Rik A T 12: 71,164,547 (GRCm38) E685V possibly damaging Het
Abca6 A G 11: 110,218,257 (GRCm38) S696P probably damaging Het
Abca9 G A 11: 110,141,610 (GRCm38) T727M probably damaging Het
Alpk2 T C 18: 65,306,241 (GRCm38) R1161G probably benign Het
Amy1 T C 3: 113,556,060 (GRCm38) D487G probably benign Het
Arap2 G A 5: 62,630,186 (GRCm38) A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 (GRCm38) Y334N probably benign Het
B4galt6 C A 18: 20,745,352 (GRCm38) probably null Het
Cacna1s G A 1: 136,086,742 (GRCm38) G382D probably damaging Het
Camk2a A G 18: 60,978,000 (GRCm38) D87G probably damaging Het
Cdh18 A G 15: 23,436,534 (GRCm38) Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 (GRCm38) G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 (GRCm38) R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 (GRCm38) S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 (GRCm38) L27F probably damaging Het
Dab1 T A 4: 104,512,264 (GRCm38) C3S probably benign Het
Dapk1 T C 13: 60,725,312 (GRCm38) F343L probably benign Het
Dgat1 A T 15: 76,502,194 (GRCm38) probably benign Het
Dnah11 C A 12: 117,880,451 (GRCm38) probably null Het
Dsg2 T A 18: 20,580,651 (GRCm38) Y226* probably null Het
Epg5 T A 18: 77,951,207 (GRCm38) M351K possibly damaging Het
F13b A G 1: 139,522,543 (GRCm38) T648A probably benign Het
Fgf17 T C 14: 70,636,968 (GRCm38) Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 (GRCm38) P435S probably benign Het
Gfm1 G A 3: 67,453,727 (GRCm38) probably null Het
Gigyf1 T C 5: 137,523,467 (GRCm38) probably benign Het
Gm12830 A T 4: 114,821,739 (GRCm38) T6S unknown Het
Gm6465 A T 5: 11,848,183 (GRCm38) N88I probably damaging Het
Gpr18 C T 14: 121,911,747 (GRCm38) V289I probably damaging Het
Ipp G T 4: 116,537,938 (GRCm38) E557* probably null Het
Klhl12 T A 1: 134,485,915 (GRCm38) probably null Het
Klhl38 A G 15: 58,322,349 (GRCm38) V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 (GRCm38) T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 (GRCm38) D2173E possibly damaging Het
Lipi T C 16: 75,573,976 (GRCm38) K118E probably benign Het
Marf1 A C 16: 14,152,231 (GRCm38) L208R probably damaging Het
Misp G A 10: 79,826,718 (GRCm38) R323K probably damaging Het
Mlxip T A 5: 123,395,327 (GRCm38) M133K probably damaging Het
Mon2 A T 10: 123,032,645 (GRCm38) M501K possibly damaging Het
Myh2 A G 11: 67,173,449 (GRCm38) I77V probably benign Het
Napa C A 7: 16,115,624 (GRCm38) Q254K probably benign Het
Nckap5l C A 15: 99,425,622 (GRCm38) G1000V probably damaging Het
Neo1 A T 9: 58,985,650 (GRCm38) S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 (GRCm38) Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 (GRCm38) P94L probably benign Het
Notch3 A T 17: 32,147,055 (GRCm38) I1024N probably benign Het
Nsd1 T A 13: 55,245,939 (GRCm38) I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 (GRCm38) D143G probably benign Het
Olfr1415 C A 1: 92,491,196 (GRCm38) K186N probably benign Het
Olfr27 A G 9: 39,144,484 (GRCm38) N128S probably benign Het
Olfr316 T A 11: 58,758,328 (GRCm38) V221E probably damaging Het
Olfr45 A C 7: 140,691,396 (GRCm38) M164L probably benign Het
Olfr77 A G 9: 19,920,379 (GRCm38) T57A probably benign Het
Olfr912 T C 9: 38,582,072 (GRCm38) V265A probably benign Het
Oplah A G 15: 76,305,446 (GRCm38) probably null Het
Phb2 T A 6: 124,713,022 (GRCm38) probably benign Het
Plcl2 A G 17: 50,509,929 (GRCm38) I108V probably benign Het
Plpp6 T A 19: 28,964,746 (GRCm38) M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 (GRCm38) G189E probably damaging Het
Ptprn C T 1: 75,251,875 (GRCm38) V853M probably damaging Het
Ptprq T C 10: 107,688,328 (GRCm38) probably null Het
Rai1 G A 11: 60,186,453 (GRCm38) V448I probably benign Het
Rbm20 T A 19: 53,851,354 (GRCm38) C925S possibly damaging Het
Rin3 C A 12: 102,313,055 (GRCm38) P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 (GRCm38) noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 (GRCm38) noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 (GRCm38) D133E probably benign Het
Ryr1 T C 7: 29,069,028 (GRCm38) K2839E possibly damaging Het
Serpinb6b T A 13: 32,977,659 (GRCm38) D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 (GRCm38) V214M probably damaging Het
Smarca2 T C 19: 26,623,936 (GRCm38) M18T probably damaging Het
Smarca2 C A 19: 26,682,046 (GRCm38) T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 (GRCm38) R46S possibly damaging Het
Spa17 A C 9: 37,611,977 (GRCm38) F5V probably damaging Het
Spag17 A G 3: 100,027,244 (GRCm38) E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 (GRCm38) probably benign Het
Tlr1 A T 5: 64,926,292 (GRCm38) V314D probably damaging Het
Trappc8 A T 18: 20,836,900 (GRCm38) L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 (GRCm38) *691Q probably null Het
Vav1 A T 17: 57,303,079 (GRCm38) K420* probably null Het
Vmn1r174 C G 7: 23,754,137 (GRCm38) T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 (GRCm38) E230G probably benign Het
Vps13b A G 15: 35,452,166 (GRCm38) T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 (GRCm38) E275G probably damaging Het
Zfp280b A G 10: 76,039,462 (GRCm38) probably null Het
Zfp763 A G 17: 33,019,533 (GRCm38) Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 (GRCm38) W161R probably benign Het
Other mutations in Sept5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Sept5 APN 16 18,624,930 (GRCm38) missense probably damaging 1.00
IGL02124:Sept5 APN 16 18,624,829 (GRCm38) missense probably damaging 0.98
IGL02211:Sept5 APN 16 18,624,879 (GRCm38) missense probably damaging 1.00
IGL02934:Sept5 APN 16 18,629,831 (GRCm38) missense probably damaging 0.99
R0518:Sept5 UTSW 16 18,624,897 (GRCm38) missense probably benign 0.02
R0521:Sept5 UTSW 16 18,624,897 (GRCm38) missense probably benign 0.02
R0627:Sept5 UTSW 16 18,625,365 (GRCm38) missense possibly damaging 0.90
R0746:Sept5 UTSW 16 18,623,225 (GRCm38) missense probably damaging 1.00
R0891:Sept5 UTSW 16 18,624,845 (GRCm38) missense probably damaging 1.00
R1037:Sept5 UTSW 16 18,623,094 (GRCm38) splice site probably benign
R1850:Sept5 UTSW 16 18,625,210 (GRCm38) missense probably damaging 1.00
R2044:Sept5 UTSW 16 18,623,012 (GRCm38) missense probably benign 0.10
R3872:Sept5 UTSW 16 18,622,973 (GRCm38) missense probably damaging 0.98
R4498:Sept5 UTSW 16 18,623,392 (GRCm38) missense probably damaging 1.00
R5963:Sept5 UTSW 16 18,624,212 (GRCm38) splice site probably null
R6286:Sept5 UTSW 16 18,623,377 (GRCm38) missense probably damaging 0.99
R7014:Sept5 UTSW 16 18,624,909 (GRCm38) missense probably damaging 1.00
R7909:Sept5 UTSW 16 18,624,622 (GRCm38) missense probably damaging 1.00
R8708:Sept5 UTSW 16 18,624,872 (GRCm38) missense probably benign 0.01
R8888:Sept5 UTSW 16 18,623,111 (GRCm38) missense possibly damaging 0.81
R8895:Sept5 UTSW 16 18,623,111 (GRCm38) missense possibly damaging 0.81
R9210:Sept5 UTSW 16 18,624,211 (GRCm38) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCTCATAGTGCACGTCGC -3'
(R):5'- TGGGTAGCAAAGACACCCAC -3'

Sequencing Primer
(F):5'- GCACGTCACATCTTTGAGGTCG -3'
(R):5'- CACAGAGGGACCATGCCATG -3'
Posted On 2016-10-05