Incidental Mutation 'R5503:Vmn2r116'
ID 430782
Institutional Source Beutler Lab
Gene Symbol Vmn2r116
Ensembl Gene ENSMUSG00000090966
Gene Name vomeronasal 2, receptor 116
Synonyms V2Rp5, EG619697
MMRRC Submission 043064-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5503 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 23384803-23401864 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23386804 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 230 (E230G)
Ref Sequence ENSEMBL: ENSMUSP00000128106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164856]
AlphaFold E9Q6I0
Predicted Effect probably benign
Transcript: ENSMUST00000164856
AA Change: E230G

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000128106
Gene: ENSMUSG00000090966
AA Change: E230G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 4.4e-30 PFAM
Pfam:NCD3G 511 564 1.2e-22 PFAM
low complexity region 589 594 N/A INTRINSIC
Pfam:7tm_3 595 832 8.7e-57 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype PHENOTYPE: Female mice homozygous for a knock-out allele stimulated with male pheromone (Gm6084) fail to exhibit an increase in lordosis behavior and successful intromission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vav1 A T 17: 57,303,079 K420* probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Vmn2r116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Vmn2r116 APN 17 23385995 missense possibly damaging 0.94
IGL00985:Vmn2r116 APN 17 23401515 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23397727 missense probably damaging 1.00
IGL00990:Vmn2r116 APN 17 23387236 missense probably benign 0.12
IGL01383:Vmn2r116 APN 17 23401601 missense probably damaging 1.00
IGL01459:Vmn2r116 APN 17 23384929 missense probably damaging 1.00
IGL01725:Vmn2r116 APN 17 23386645 missense probably damaging 1.00
IGL02125:Vmn2r116 APN 17 23397627 splice site probably benign
IGL02170:Vmn2r116 APN 17 23384933 missense probably benign
IGL02209:Vmn2r116 APN 17 23388787 missense probably damaging 1.00
IGL02226:Vmn2r116 APN 17 23384834 missense probably null
IGL02272:Vmn2r116 APN 17 23385999 missense probably benign 0.06
IGL02272:Vmn2r116 APN 17 23386004 missense probably damaging 1.00
IGL02403:Vmn2r116 APN 17 23387364 missense probably damaging 1.00
IGL02686:Vmn2r116 APN 17 23388793 missense probably damaging 0.99
IGL02750:Vmn2r116 APN 17 23397634 splice site probably benign
IGL02977:Vmn2r116 APN 17 23388774 missense possibly damaging 0.90
PIT4449001:Vmn2r116 UTSW 17 23388947 missense probably benign 0.41
R0015:Vmn2r116 UTSW 17 23401849 missense probably benign 0.03
R0219:Vmn2r116 UTSW 17 23386098 nonsense probably null
R0281:Vmn2r116 UTSW 17 23401413 missense possibly damaging 0.90
R0415:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
R0592:Vmn2r116 UTSW 17 23386915 missense probably damaging 0.99
R0610:Vmn2r116 UTSW 17 23387312 missense probably damaging 1.00
R0635:Vmn2r116 UTSW 17 23386887 missense possibly damaging 0.95
R0843:Vmn2r116 UTSW 17 23400960 missense probably benign 0.01
R1329:Vmn2r116 UTSW 17 23387188 missense possibly damaging 0.89
R1396:Vmn2r116 UTSW 17 23386141 missense probably benign
R1401:Vmn2r116 UTSW 17 23386596 splice site probably benign
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1574:Vmn2r116 UTSW 17 23387089 missense probably damaging 0.99
R1766:Vmn2r116 UTSW 17 23401766 missense probably damaging 0.98
R2157:Vmn2r116 UTSW 17 23401469 missense probably damaging 1.00
R3622:Vmn2r116 UTSW 17 23386051 missense probably benign 0.11
R3690:Vmn2r116 UTSW 17 23384824 missense unknown
R4298:Vmn2r116 UTSW 17 23401827 missense possibly damaging 0.69
R4373:Vmn2r116 UTSW 17 23401421 missense probably benign 0.01
R4860:Vmn2r116 UTSW 17 23401803 missense probably benign
R4941:Vmn2r116 UTSW 17 23401142 missense probably damaging 1.00
R5119:Vmn2r116 UTSW 17 23387164 missense probably benign 0.01
R5510:Vmn2r116 UTSW 17 23386121 missense probably damaging 1.00
R5538:Vmn2r116 UTSW 17 23401067 missense probably benign 0.00
R5689:Vmn2r116 UTSW 17 23397719 missense probably benign 0.30
R5765:Vmn2r116 UTSW 17 23401404 missense probably damaging 0.99
R5794:Vmn2r116 UTSW 17 23385968 missense probably damaging 0.99
R5807:Vmn2r116 UTSW 17 23387307 missense probably damaging 1.00
R5837:Vmn2r116 UTSW 17 23387080 missense probably damaging 1.00
R6262:Vmn2r116 UTSW 17 23387377 missense probably benign 0.03
R6298:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R6651:Vmn2r116 UTSW 17 23388831 nonsense probably null
R6667:Vmn2r116 UTSW 17 23401092 missense probably damaging 1.00
R7393:Vmn2r116 UTSW 17 23386125 missense probably benign 0.14
R7571:Vmn2r116 UTSW 17 23384856 splice site probably null
R7940:Vmn2r116 UTSW 17 23386972 missense probably damaging 0.99
R8510:Vmn2r116 UTSW 17 23385931 nonsense probably null
R8950:Vmn2r116 UTSW 17 23401493 missense probably damaging 1.00
R8956:Vmn2r116 UTSW 17 23386762 missense probably damaging 1.00
R8977:Vmn2r116 UTSW 17 23386942 missense possibly damaging 0.56
R9030:Vmn2r116 UTSW 17 23384890 missense possibly damaging 0.82
R9077:Vmn2r116 UTSW 17 23385982 missense probably benign 0.14
R9223:Vmn2r116 UTSW 17 23401167 missense probably damaging 1.00
R9401:Vmn2r116 UTSW 17 23401592 missense probably damaging 1.00
R9449:Vmn2r116 UTSW 17 23386945 missense probably benign 0.01
R9746:Vmn2r116 UTSW 17 23401823 missense probably benign 0.08
R9755:Vmn2r116 UTSW 17 23401091 missense probably damaging 1.00
R9759:Vmn2r116 UTSW 17 23401386 missense possibly damaging 0.90
R9800:Vmn2r116 UTSW 17 23401425 missense probably damaging 0.97
S24628:Vmn2r116 UTSW 17 23387279 missense possibly damaging 0.55
Z1176:Vmn2r116 UTSW 17 23401428 missense probably damaging 1.00
Z1177:Vmn2r116 UTSW 17 23388892 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCCTGCCCTGAGTGATCATG -3'
(R):5'- ACTGACATCCCACTGTGAGG -3'

Sequencing Primer
(F):5'- CCCTGAGTGATCATGAAAAATTTCCC -3'
(R):5'- GATCCATAGTCTCTGTATACCTAGGG -3'
Posted On 2016-10-05