Mutagenetix > Incidental Mutations

Incidental Mutation 'R5503:Vav1'

430785

Institutional Source

Beutler Lab

Gene Symbol

Vav1

Ensembl Gene

ENSMUSG00000034116

Gene Name

vav 1 oncogene

Synonyms

MMRRC Submission

043064-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R5503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57279100-57328031 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 57303079 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 420 (K420*)

Ref Sequence

ENSEMBL: ENSMUSP00000126694 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]

Predicted Effect

probably null
Transcript: ENSMUST00000005889
AA Change: K444*

SMART Domains

Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: K444*

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	669	751	8.88e-25	SMART
SH3	785	841	1.44e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112870
AA Change: K444*

SMART Domains

Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: K444*

Domain	Start	End	E-Value	Type
CH	3	115	5.69e-15	SMART
RhoGEF	198	372	7.89e-62	SMART
PH	403	506	8.45e-12	SMART
C1	516	564	3.67e-9	SMART
SH3	595	659	1.65e-8	SMART
SH2	633	712	3.93e-2	SMART
SH3	746	802	1.44e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000169220
AA Change: K420*

SMART Domains

Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: K420*

Domain	Start	End	E-Value	Type
Pfam:CAMSAP_CH	27	79	6.2e-11	PFAM
RhoGEF	174	348	7.89e-62	SMART
PH	379	482	8.45e-12	SMART
C1	492	540	3.67e-9	SMART
SH3	571	635	1.65e-8	SMART
SH2	645	727	8.88e-25	SMART
SH3	761	817	1.44e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174878

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Alpk2	T	C	18: 65,306,241	R1161G	probably benign	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Vav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Vav1	APN	17	57299176	missense	probably benign	0.21
IGL01613:Vav1	APN	17	57307067	missense	possibly damaging	0.93
IGL02032:Vav1	APN	17	57297090	missense	possibly damaging	0.91
IGL02213:Vav1	APN	17	57305351	missense	possibly damaging	0.84
IGL03009:Vav1	APN	17	57296582	missense	probably benign	0.38
Belated	UTSW	17	57301214	missense	probably benign	0.06
Delayed	UTSW	17	57296552	missense	probably damaging	1.00
finally	UTSW	17	57311860	nonsense	probably null
Last	UTSW	17	57296039	missense	probably damaging	0.99
Late	UTSW	17	57301870	missense	possibly damaging	0.91
Plain_sight	UTSW	17	57297122	missense	probably damaging	1.00
tardive	UTSW	17	57303079	nonsense	probably null
R0116:Vav1	UTSW	17	57296039	missense	probably damaging	0.99
R0125:Vav1	UTSW	17	57299847	missense	probably damaging	1.00
R0268:Vav1	UTSW	17	57296090	missense	probably damaging	1.00
R0344:Vav1	UTSW	17	57296090	missense	probably damaging	1.00
R0579:Vav1	UTSW	17	57279271	missense	probably benign	0.01
R0634:Vav1	UTSW	17	57303862	missense	probably benign	0.00
R1313:Vav1	UTSW	17	57309498	splice site	probably benign
R1345:Vav1	UTSW	17	57301214	missense	probably benign	0.06
R1402:Vav1	UTSW	17	57303849	missense	probably benign	0.18
R1402:Vav1	UTSW	17	57303849	missense	probably benign	0.18
R1579:Vav1	UTSW	17	57297252	missense	probably benign	0.05
R1872:Vav1	UTSW	17	57324750	missense	probably damaging	1.00
R1971:Vav1	UTSW	17	57327697	missense	probably damaging	1.00
R2197:Vav1	UTSW	17	57303140	missense	probably benign	0.37
R2903:Vav1	UTSW	17	57306187	missense	probably benign	0.05
R4623:Vav1	UTSW	17	57299839	splice site	probably null
R4753:Vav1	UTSW	17	57306140	missense	probably damaging	0.98
R4779:Vav1	UTSW	17	57296552	missense	probably damaging	1.00
R5232:Vav1	UTSW	17	57303846	missense	possibly damaging	0.81
R5240:Vav1	UTSW	17	57297122	missense	probably damaging	1.00
R5592:Vav1	UTSW	17	57304835	missense	probably benign	0.00
R5782:Vav1	UTSW	17	57296001	missense	probably damaging	1.00
R5945:Vav1	UTSW	17	57301870	missense	possibly damaging	0.91
R6113:Vav1	UTSW	17	57301884	missense	probably benign	0.00
R6514:Vav1	UTSW	17	57327660	missense	probably damaging	1.00
R6575:Vav1	UTSW	17	57305280	missense	probably damaging	0.97
R6932:Vav1	UTSW	17	57302330	missense	possibly damaging	0.92
R7024:Vav1	UTSW	17	57279268	missense	probably damaging	1.00
R7063:Vav1	UTSW	17	57311860	nonsense	probably null
R7322:Vav1	UTSW	17	57302266	missense	probably benign
R7335:Vav1	UTSW	17	57296720	missense	probably benign
R7474:Vav1	UTSW	17	57299102	missense	probably benign	0.07
R7665:Vav1	UTSW	17	57297086	missense	probably damaging	1.00
Z1176:Vav1	UTSW	17	57303853	missense	probably damaging	1.00
Z1177:Vav1	UTSW	17	57303040	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- GGTTAAGGTTAGGATGCGAACC -3'
(R):5'- AGGCTGTCTAGACCATCCAAAC -3'

Sequencing Primer
(F):5'- GTTAGGATGCGAACCCACAGC -3'
(R):5'- GAGGTTGCCTCTGAACTCTAAC -3'

Posted On

2016-10-05