Incidental Mutation 'R5503:Vav1'
ID430785
Institutional Source Beutler Lab
Gene Symbol Vav1
Ensembl Gene ENSMUSG00000034116
Gene Namevav 1 oncogene
Synonyms
MMRRC Submission 043064-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R5503 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location57279100-57328031 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 57303079 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 420 (K420*)
Ref Sequence ENSEMBL: ENSMUSP00000126694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005889] [ENSMUST00000112870] [ENSMUST00000169220]
Predicted Effect probably null
Transcript: ENSMUST00000005889
AA Change: K444*
SMART Domains Protein: ENSMUSP00000005889
Gene: ENSMUSG00000034116
AA Change: K444*

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 669 751 8.88e-25 SMART
SH3 785 841 1.44e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112870
AA Change: K444*
SMART Domains Protein: ENSMUSP00000108491
Gene: ENSMUSG00000034116
AA Change: K444*

DomainStartEndE-ValueType
CH 3 115 5.69e-15 SMART
RhoGEF 198 372 7.89e-62 SMART
PH 403 506 8.45e-12 SMART
C1 516 564 3.67e-9 SMART
SH3 595 659 1.65e-8 SMART
SH2 633 712 3.93e-2 SMART
SH3 746 802 1.44e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169220
AA Change: K420*
SMART Domains Protein: ENSMUSP00000126694
Gene: ENSMUSG00000034116
AA Change: K420*

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 27 79 6.2e-11 PFAM
RhoGEF 174 348 7.89e-62 SMART
PH 379 482 8.45e-12 SMART
C1 492 540 3.67e-9 SMART
SH3 571 635 1.65e-8 SMART
SH2 645 727 8.88e-25 SMART
SH3 761 817 1.44e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174878
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.5%
Validation Efficiency 96% (103/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. The encoded protein is important in hematopoiesis, playing a role in T-cell and B-cell development and activation. The encoded protein has been identified as the specific binding partner of Nef proteins from HIV-1. Coexpression and binding of these partners initiates profound morphological changes, cytoskeletal rearrangements and the JNK/SAPK signaling cascade, leading to increased levels of viral transcription and replication. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mutants exhibit defective T cell maturation, interleukin-2 production, and cell cycle progression. Immunoglobulin class switching is also impaired and attributed to defective T cell help. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca6 A G 11: 110,218,257 S696P probably damaging Het
Abca9 G A 11: 110,141,610 T727M probably damaging Het
Alpk2 T C 18: 65,306,241 R1161G probably benign Het
Amy1 T C 3: 113,556,060 D487G probably benign Het
Arap2 G A 5: 62,630,186 A1409V probably damaging Het
B020004J07Rik A T 4: 101,835,802 Y334N probably benign Het
B4galt6 C A 18: 20,745,352 probably null Het
Cacna1s G A 1: 136,086,742 G382D probably damaging Het
Camk2a A G 18: 60,978,000 D87G probably damaging Het
Cdh18 A G 15: 23,436,534 Y492C probably damaging Het
Col18a1 C T 10: 77,071,620 G861D probably damaging Het
Col4a3bp C T 13: 96,543,239 R26C possibly damaging Het
Crybg1 C A 10: 43,998,766 S782I probably benign Het
Csgalnact1 G A 8: 68,461,473 L27F probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dapk1 T C 13: 60,725,312 F343L probably benign Het
Dgat1 A T 15: 76,502,194 probably benign Het
Dnah11 C A 12: 117,880,451 probably null Het
Dsg2 T A 18: 20,580,651 Y226* probably null Het
Epg5 T A 18: 77,951,207 M351K possibly damaging Het
F13b A G 1: 139,522,543 T648A probably benign Het
Fgf17 T C 14: 70,636,968 Y127C probably damaging Het
Fkbp15 G A 4: 62,327,887 P435S probably benign Het
Gfm1 G A 3: 67,453,727 probably null Het
Gigyf1 T C 5: 137,523,467 probably benign Het
Gm12830 A T 4: 114,821,739 T6S unknown Het
Gm6465 A T 5: 11,848,183 N88I probably damaging Het
Gpr18 C T 14: 121,911,747 V289I probably damaging Het
Ipp G T 4: 116,537,938 E557* probably null Het
Klhl12 T A 1: 134,485,915 probably null Het
Klhl38 A G 15: 58,322,349 V328A possibly damaging Het
Kndc1 A G 7: 139,931,889 T1470A probably damaging Het
Kntc1 T A 5: 123,819,876 D2173E possibly damaging Het
Lipi T C 16: 75,573,976 K118E probably benign Het
Marf1 A C 16: 14,152,231 L208R probably damaging Het
Misp G A 10: 79,826,718 R323K probably damaging Het
Mlxip T A 5: 123,395,327 M133K probably damaging Het
Mon2 A T 10: 123,032,645 M501K possibly damaging Het
Myh2 A G 11: 67,173,449 I77V probably benign Het
Napa C A 7: 16,115,624 Q254K probably benign Het
Nckap5l C A 15: 99,425,622 G1000V probably damaging Het
Neo1 A T 9: 58,985,650 S236R possibly damaging Het
Neurl4 T A 11: 69,906,368 Y594N probably damaging Het
Nmral1 G A 16: 4,715,629 P94L probably benign Het
Notch3 A T 17: 32,147,055 I1024N probably benign Het
Nsd1 T A 13: 55,245,939 I451K probably damaging Het
Nt5c3b T C 11: 100,433,057 D143G probably benign Het
Olfr1415 C A 1: 92,491,196 K186N probably benign Het
Olfr27 A G 9: 39,144,484 N128S probably benign Het
Olfr316 T A 11: 58,758,328 V221E probably damaging Het
Olfr45 A C 7: 140,691,396 M164L probably benign Het
Olfr77 A G 9: 19,920,379 T57A probably benign Het
Olfr912 T C 9: 38,582,072 V265A probably benign Het
Oplah A G 15: 76,305,446 probably null Het
Phb2 T A 6: 124,713,022 probably benign Het
Plcl2 A G 17: 50,509,929 I108V probably benign Het
Plpp6 T A 19: 28,964,746 M249K probably damaging Het
Pnpt1 G A 11: 29,138,156 G189E probably damaging Het
Ptprn C T 1: 75,251,875 V853M probably damaging Het
Ptprq T C 10: 107,688,328 probably null Het
Rai1 G A 11: 60,186,453 V448I probably benign Het
Rbm20 T A 19: 53,851,354 C925S possibly damaging Het
Rin3 C A 12: 102,313,055 P41Q probably benign Het
Rpl31-ps21 T C 5: 21,119,507 noncoding transcript Het
Rpl39-ps A T 15: 102,635,126 noncoding transcript Het
Rtn4ip1 T A 10: 43,907,883 D133E probably benign Het
Ryr1 T C 7: 29,069,028 K2839E possibly damaging Het
Sept5 T C 16: 18,623,368 K268R probably benign Het
Serpinb6b T A 13: 32,977,659 D238E possibly damaging Het
Slc15a2 C T 16: 36,762,385 V214M probably damaging Het
Smarca2 T C 19: 26,623,936 M18T probably damaging Het
Smarca2 C A 19: 26,682,046 T912K possibly damaging Het
Smdt1 A T 15: 82,347,900 R46S possibly damaging Het
Spa17 A C 9: 37,611,977 F5V probably damaging Het
Spag17 A G 3: 100,027,244 E614G possibly damaging Het
Sstr4 CGAGGAGGAGGAGGA CGAGGAGGAGGAGGAGGA 2: 148,395,551 probably benign Het
Tlr1 A T 5: 64,926,292 V314D probably damaging Het
Trappc8 A T 18: 20,836,900 L1011Q probably benign Het
Tsga10 A G 1: 37,760,947 *691Q probably null Het
Vmn1r174 C G 7: 23,754,137 T76R probably benign Het
Vmn2r116 A G 17: 23,386,804 E230G probably benign Het
Vps13b A G 15: 35,452,166 T637A probably damaging Het
Zbtb7a A G 10: 81,144,797 E275G probably damaging Het
Zfp280b A G 10: 76,039,462 probably null Het
Zfp763 A G 17: 33,019,533 Y213H possibly damaging Het
Zfp78 T A 7: 6,378,529 W161R probably benign Het
Other mutations in Vav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Vav1 APN 17 57299176 missense probably benign 0.21
IGL01613:Vav1 APN 17 57307067 missense possibly damaging 0.93
IGL02032:Vav1 APN 17 57297090 missense possibly damaging 0.91
IGL02213:Vav1 APN 17 57305351 missense possibly damaging 0.84
IGL03009:Vav1 APN 17 57296582 missense probably benign 0.38
Belated UTSW 17 57301214 missense probably benign 0.06
Delayed UTSW 17 57296552 missense probably damaging 1.00
finally UTSW 17 57311860 nonsense probably null
Last UTSW 17 57296039 missense probably damaging 0.99
Late UTSW 17 57301870 missense possibly damaging 0.91
Plain_sight UTSW 17 57297122 missense probably damaging 1.00
tardive UTSW 17 57303079 nonsense probably null
R0116:Vav1 UTSW 17 57296039 missense probably damaging 0.99
R0125:Vav1 UTSW 17 57299847 missense probably damaging 1.00
R0268:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0344:Vav1 UTSW 17 57296090 missense probably damaging 1.00
R0579:Vav1 UTSW 17 57279271 missense probably benign 0.01
R0634:Vav1 UTSW 17 57303862 missense probably benign 0.00
R1313:Vav1 UTSW 17 57309498 splice site probably benign
R1345:Vav1 UTSW 17 57301214 missense probably benign 0.06
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1402:Vav1 UTSW 17 57303849 missense probably benign 0.18
R1579:Vav1 UTSW 17 57297252 missense probably benign 0.05
R1872:Vav1 UTSW 17 57324750 missense probably damaging 1.00
R1971:Vav1 UTSW 17 57327697 missense probably damaging 1.00
R2197:Vav1 UTSW 17 57303140 missense probably benign 0.37
R2903:Vav1 UTSW 17 57306187 missense probably benign 0.05
R4623:Vav1 UTSW 17 57299839 splice site probably null
R4753:Vav1 UTSW 17 57306140 missense probably damaging 0.98
R4779:Vav1 UTSW 17 57296552 missense probably damaging 1.00
R5232:Vav1 UTSW 17 57303846 missense possibly damaging 0.81
R5240:Vav1 UTSW 17 57297122 missense probably damaging 1.00
R5592:Vav1 UTSW 17 57304835 missense probably benign 0.00
R5782:Vav1 UTSW 17 57296001 missense probably damaging 1.00
R5945:Vav1 UTSW 17 57301870 missense possibly damaging 0.91
R6113:Vav1 UTSW 17 57301884 missense probably benign 0.00
R6514:Vav1 UTSW 17 57327660 missense probably damaging 1.00
R6575:Vav1 UTSW 17 57305280 missense probably damaging 0.97
R6932:Vav1 UTSW 17 57302330 missense possibly damaging 0.92
R7024:Vav1 UTSW 17 57279268 missense probably damaging 1.00
R7063:Vav1 UTSW 17 57311860 nonsense probably null
R7322:Vav1 UTSW 17 57302266 missense probably benign
R7335:Vav1 UTSW 17 57296720 missense probably benign
R7474:Vav1 UTSW 17 57299102 missense probably benign 0.07
R7665:Vav1 UTSW 17 57297086 missense probably damaging 1.00
Z1176:Vav1 UTSW 17 57303853 missense probably damaging 1.00
Z1177:Vav1 UTSW 17 57303040 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GGTTAAGGTTAGGATGCGAACC -3'
(R):5'- AGGCTGTCTAGACCATCCAAAC -3'

Sequencing Primer
(F):5'- GTTAGGATGCGAACCCACAGC -3'
(R):5'- GAGGTTGCCTCTGAACTCTAAC -3'
Posted On2016-10-05