Mutagenetix > Incidental Mutation

Incidental Mutation 'R5503:Alpk2'

430790

Institutional Source

Beutler Lab

Gene Symbol

Alpk2

Ensembl Gene

ENSMUSG00000032845

Gene Name

alpha-kinase 2

Synonyms

Hak

MMRRC Submission

043064-MU

Accession Numbers

Genbank: NM_001037294

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5503 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65265529-65393888 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65306241 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1161 (R1161G)

Ref Sequence

ENSEMBL: ENSMUSP00000048752 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]

AlphaFold

Q91ZB0

Predicted Effect

probably benign
Transcript: ENSMUST00000035548
AA Change: R1161G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: R1161G

Domain	Start	End	E-Value	Type
IGc2	24	94	9.34e-4	SMART
low complexity region	196	209	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
low complexity region	1337	1353	N/A	INTRINSIC
IG	1766	1849	2.27e-2	SMART
Alpha_kinase	1879	2098	3.72e-79	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000141250
AA Change: R694G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845
AA Change: R694G

Domain	Start	End	E-Value	Type
low complexity region	255	267	N/A	INTRINSIC
low complexity region	558	570	N/A	INTRINSIC
low complexity region	870	886	N/A	INTRINSIC
IG	1299	1382	2.27e-2	SMART
Alpha_kinase	1412	1603	2.45e-56	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.3%
3x: 97.4%
10x: 95.4%
20x: 91.5%

Validation Efficiency

96% (103/107)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca6	A	G	11: 110,218,257	S696P	probably damaging	Het
Abca9	G	A	11: 110,141,610	T727M	probably damaging	Het
Amy1	T	C	3: 113,556,060	D487G	probably benign	Het
Arap2	G	A	5: 62,630,186	A1409V	probably damaging	Het
B020004J07Rik	A	T	4: 101,835,802	Y334N	probably benign	Het
B4galt6	C	A	18: 20,745,352		probably null	Het
Cacna1s	G	A	1: 136,086,742	G382D	probably damaging	Het
Camk2a	A	G	18: 60,978,000	D87G	probably damaging	Het
Cdh18	A	G	15: 23,436,534	Y492C	probably damaging	Het
Col18a1	C	T	10: 77,071,620	G861D	probably damaging	Het
Col4a3bp	C	T	13: 96,543,239	R26C	possibly damaging	Het
Crybg1	C	A	10: 43,998,766	S782I	probably benign	Het
Csgalnact1	G	A	8: 68,461,473	L27F	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dapk1	T	C	13: 60,725,312	F343L	probably benign	Het
Dgat1	A	T	15: 76,502,194		probably benign	Het
Dnah11	C	A	12: 117,880,451		probably null	Het
Dsg2	T	A	18: 20,580,651	Y226*	probably null	Het
Epg5	T	A	18: 77,951,207	M351K	possibly damaging	Het
F13b	A	G	1: 139,522,543	T648A	probably benign	Het
Fgf17	T	C	14: 70,636,968	Y127C	probably damaging	Het
Fkbp15	G	A	4: 62,327,887	P435S	probably benign	Het
Gfm1	G	A	3: 67,453,727		probably null	Het
Gigyf1	T	C	5: 137,523,467		probably benign	Het
Gm12830	A	T	4: 114,821,739	T6S	unknown	Het
Gm6465	A	T	5: 11,848,183	N88I	probably damaging	Het
Gpr18	C	T	14: 121,911,747	V289I	probably damaging	Het
Ipp	G	T	4: 116,537,938	E557*	probably null	Het
Klhl12	T	A	1: 134,485,915		probably null	Het
Klhl38	A	G	15: 58,322,349	V328A	possibly damaging	Het
Kndc1	A	G	7: 139,931,889	T1470A	probably damaging	Het
Kntc1	T	A	5: 123,819,876	D2173E	possibly damaging	Het
Lipi	T	C	16: 75,573,976	K118E	probably benign	Het
Marf1	A	C	16: 14,152,231	L208R	probably damaging	Het
Misp	G	A	10: 79,826,718	R323K	probably damaging	Het
Mlxip	T	A	5: 123,395,327	M133K	probably damaging	Het
Mon2	A	T	10: 123,032,645	M501K	possibly damaging	Het
Myh2	A	G	11: 67,173,449	I77V	probably benign	Het
Napa	C	A	7: 16,115,624	Q254K	probably benign	Het
Nckap5l	C	A	15: 99,425,622	G1000V	probably damaging	Het
Neo1	A	T	9: 58,985,650	S236R	possibly damaging	Het
Neurl4	T	A	11: 69,906,368	Y594N	probably damaging	Het
Nmral1	G	A	16: 4,715,629	P94L	probably benign	Het
Notch3	A	T	17: 32,147,055	I1024N	probably benign	Het
Nsd1	T	A	13: 55,245,939	I451K	probably damaging	Het
Nt5c3b	T	C	11: 100,433,057	D143G	probably benign	Het
Olfr1415	C	A	1: 92,491,196	K186N	probably benign	Het
Olfr27	A	G	9: 39,144,484	N128S	probably benign	Het
Olfr316	T	A	11: 58,758,328	V221E	probably damaging	Het
Olfr45	A	C	7: 140,691,396	M164L	probably benign	Het
Olfr77	A	G	9: 19,920,379	T57A	probably benign	Het
Olfr912	T	C	9: 38,582,072	V265A	probably benign	Het
Oplah	A	G	15: 76,305,446		probably null	Het
Phb2	T	A	6: 124,713,022		probably benign	Het
Plcl2	A	G	17: 50,509,929	I108V	probably benign	Het
Plpp6	T	A	19: 28,964,746	M249K	probably damaging	Het
Pnpt1	G	A	11: 29,138,156	G189E	probably damaging	Het
Ptprn	C	T	1: 75,251,875	V853M	probably damaging	Het
Ptprq	T	C	10: 107,688,328		probably null	Het
Rai1	G	A	11: 60,186,453	V448I	probably benign	Het
Rbm20	T	A	19: 53,851,354	C925S	possibly damaging	Het
Rin3	C	A	12: 102,313,055	P41Q	probably benign	Het
Rpl31-ps21	T	C	5: 21,119,507		noncoding transcript	Het
Rpl39-ps	A	T	15: 102,635,126		noncoding transcript	Het
Rtn4ip1	T	A	10: 43,907,883	D133E	probably benign	Het
Ryr1	T	C	7: 29,069,028	K2839E	possibly damaging	Het
Sept5	T	C	16: 18,623,368	K268R	probably benign	Het
Serpinb6b	T	A	13: 32,977,659	D238E	possibly damaging	Het
Slc15a2	C	T	16: 36,762,385	V214M	probably damaging	Het
Smarca2	T	C	19: 26,623,936	M18T	probably damaging	Het
Smarca2	C	A	19: 26,682,046	T912K	possibly damaging	Het
Smdt1	A	T	15: 82,347,900	R46S	possibly damaging	Het
Spa17	A	C	9: 37,611,977	F5V	probably damaging	Het
Spag17	A	G	3: 100,027,244	E614G	possibly damaging	Het
Sstr4	CGAGGAGGAGGAGGA	CGAGGAGGAGGAGGAGGA	2: 148,395,551		probably benign	Het
Tlr1	A	T	5: 64,926,292	V314D	probably damaging	Het
Trappc8	A	T	18: 20,836,900	L1011Q	probably benign	Het
Tsga10	A	G	1: 37,760,947	*691Q	probably null	Het
Vav1	A	T	17: 57,303,079	K420*	probably null	Het
Vmn1r174	C	G	7: 23,754,137	T76R	probably benign	Het
Vmn2r116	A	G	17: 23,386,804	E230G	probably benign	Het
Vps13b	A	G	15: 35,452,166	T637A	probably damaging	Het
Zbtb7a	A	G	10: 81,144,797	E275G	probably damaging	Het
Zfp280b	A	G	10: 76,039,462		probably null	Het
Zfp763	A	G	17: 33,019,533	Y213H	possibly damaging	Het
Zfp78	T	A	7: 6,378,529	W161R	probably benign	Het

Other mutations in Alpk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Alpk2	APN	18	65305823	missense	probably benign	0.27
IGL00478:Alpk2	APN	18	65307226	nonsense	probably null
IGL00898:Alpk2	APN	18	65350573	missense	probably benign	0.29
IGL00978:Alpk2	APN	18	65291534	splice site	probably benign
IGL01093:Alpk2	APN	18	65349329	missense	probably damaging	0.98
IGL01094:Alpk2	APN	18	65306602	missense	probably damaging	0.96
IGL01109:Alpk2	APN	18	65307140	missense	probably benign	0.09
IGL01370:Alpk2	APN	18	65350591	missense	possibly damaging	0.56
IGL01393:Alpk2	APN	18	65307708	missense	possibly damaging	0.88
IGL01629:Alpk2	APN	18	65300042	missense	probably damaging	1.00
IGL01872:Alpk2	APN	18	65304753	missense	probably benign	0.01
IGL01983:Alpk2	APN	18	65350682	missense	probably damaging	1.00
IGL02294:Alpk2	APN	18	65306075	missense	possibly damaging	0.45
IGL02333:Alpk2	APN	18	65349480	missense	probably damaging	0.99
IGL02493:Alpk2	APN	18	65350331	missense	probably benign	0.02
IGL02551:Alpk2	APN	18	65372751	missense	probably damaging	1.00
IGL02864:Alpk2	APN	18	65307599	missense	probably benign	0.12
IGL02901:Alpk2	APN	18	65306411	missense	probably benign
IGL02954:Alpk2	APN	18	65306136	missense	probably benign
IGL03257:Alpk2	APN	18	65349874	missense	probably damaging	0.99
IGL03389:Alpk2	APN	18	65304866	missense	possibly damaging	0.92
3-1:Alpk2	UTSW	18	65304888	missense	probably damaging	0.99
PIT4131001:Alpk2	UTSW	18	65306379	missense	possibly damaging	0.84
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0098:Alpk2	UTSW	18	65349911	missense	probably damaging	1.00
R0414:Alpk2	UTSW	18	65306159	missense	probably benign	0.04
R0546:Alpk2	UTSW	18	65306717	missense	probably benign	0.05
R0628:Alpk2	UTSW	18	65307296	missense	possibly damaging	0.94
R0658:Alpk2	UTSW	18	65349487	missense	probably damaging	1.00
R0731:Alpk2	UTSW	18	65305390	missense	probably damaging	0.98
R0919:Alpk2	UTSW	18	65307473	missense	probably benign
R1069:Alpk2	UTSW	18	65305014	missense	probably benign	0.25
R1186:Alpk2	UTSW	18	65294341	critical splice acceptor site	probably null
R1508:Alpk2	UTSW	18	65349305	missense	probably damaging	1.00
R1535:Alpk2	UTSW	18	65350204	missense	probably benign
R1558:Alpk2	UTSW	18	65350230	missense	probably benign
R1600:Alpk2	UTSW	18	65378037	missense	probably damaging	0.96
R1664:Alpk2	UTSW	18	65349873	missense	probably damaging	0.96
R1672:Alpk2	UTSW	18	65280959	missense	probably damaging	1.00
R1829:Alpk2	UTSW	18	65294094	missense	possibly damaging	0.75
R2110:Alpk2	UTSW	18	65307080	missense	possibly damaging	0.94
R2111:Alpk2	UTSW	18	65349774	missense	probably benign
R2113:Alpk2	UTSW	18	65305683	missense	probably benign	0.31
R2126:Alpk2	UTSW	18	65350368	nonsense	probably null
R2198:Alpk2	UTSW	18	65350184	missense	probably benign	0.42
R2227:Alpk2	UTSW	18	65378076	missense	probably damaging	1.00
R2245:Alpk2	UTSW	18	65305163	missense	probably benign	0.02
R2282:Alpk2	UTSW	18	65307626	missense	probably benign
R2421:Alpk2	UTSW	18	65306616	missense	probably benign	0.00
R2512:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R3105:Alpk2	UTSW	18	65350210	missense	possibly damaging	0.57
R3700:Alpk2	UTSW	18	65305151	missense	probably damaging	0.99
R4205:Alpk2	UTSW	18	65305211	missense	possibly damaging	0.76
R4239:Alpk2	UTSW	18	65300141	missense	probably damaging	1.00
R4353:Alpk2	UTSW	18	65291452	missense	possibly damaging	0.73
R4572:Alpk2	UTSW	18	65281004	missense	probably damaging	1.00
R4584:Alpk2	UTSW	18	65306964	missense	probably damaging	0.99
R4591:Alpk2	UTSW	18	65305823	missense	probably benign	0.27
R4595:Alpk2	UTSW	18	65289748	missense	probably damaging	1.00
R4648:Alpk2	UTSW	18	65349882	missense	probably damaging	0.99
R4815:Alpk2	UTSW	18	65349955	missense	probably damaging	1.00
R4828:Alpk2	UTSW	18	65349113	missense	probably benign
R4910:Alpk2	UTSW	18	65266286	nonsense	probably null
R5042:Alpk2	UTSW	18	65350508	nonsense	probably null
R5295:Alpk2	UTSW	18	65305038	missense	probably damaging	0.98
R5375:Alpk2	UTSW	18	65372738	missense	probably damaging	1.00
R5475:Alpk2	UTSW	18	65307012	missense	probably benign	0.16
R5480:Alpk2	UTSW	18	65349908	missense	probably damaging	1.00
R5486:Alpk2	UTSW	18	65294354	splice site	probably null
R5595:Alpk2	UTSW	18	65266248	missense	probably damaging	1.00
R5648:Alpk2	UTSW	18	65349917	missense	probably damaging	0.96
R5714:Alpk2	UTSW	18	65305461	missense	possibly damaging	0.55
R5862:Alpk2	UTSW	18	65307289	missense	probably damaging	1.00
R5894:Alpk2	UTSW	18	65281072	missense	probably damaging	0.99
R5898:Alpk2	UTSW	18	65307623	missense	probably damaging	0.99
R5936:Alpk2	UTSW	18	65350520	missense	probably damaging	0.96
R6142:Alpk2	UTSW	18	65305385	missense	possibly damaging	0.94
R6291:Alpk2	UTSW	18	65305901	missense	possibly damaging	0.93
R6339:Alpk2	UTSW	18	65349806	missense	probably benign	0.00
R6407:Alpk2	UTSW	18	65289738	missense	probably benign	0.22
R6487:Alpk2	UTSW	18	65266183	missense	possibly damaging	0.62
R6667:Alpk2	UTSW	18	65307740	missense	probably damaging	1.00
R6786:Alpk2	UTSW	18	65306634	missense	probably benign
R6833:Alpk2	UTSW	18	65306409	missense	probably benign	0.08
R6984:Alpk2	UTSW	18	65305678	missense	possibly damaging	0.95
R6999:Alpk2	UTSW	18	65304513	missense	probably damaging	0.99
R7157:Alpk2	UTSW	18	65266277	nonsense	probably null
R7167:Alpk2	UTSW	18	65306978	missense	probably benign	0.40
R7225:Alpk2	UTSW	18	65305199	missense	probably benign	0.00
R7409:Alpk2	UTSW	18	65306952	missense	probably benign	0.01
R7533:Alpk2	UTSW	18	65304603	missense	probably damaging	1.00
R7576:Alpk2	UTSW	18	65306816	missense	possibly damaging	0.89
R7589:Alpk2	UTSW	18	65300073	missense	probably damaging	1.00
R7598:Alpk2	UTSW	18	65304566	missense	probably damaging	1.00
R7664:Alpk2	UTSW	18	65307002	missense	probably benign	0.03
R7711:Alpk2	UTSW	18	65306484	missense	probably benign
R7722:Alpk2	UTSW	18	65350157	missense	probably damaging	1.00
R7783:Alpk2	UTSW	18	65306254	nonsense	probably null
R7806:Alpk2	UTSW	18	65349416	missense	probably benign
R7953:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8024:Alpk2	UTSW	18	65305035	missense	probably benign	0.01
R8043:Alpk2	UTSW	18	65349830	missense	probably damaging	1.00
R8063:Alpk2	UTSW	18	65350346	missense	probably benign	0.15
R8171:Alpk2	UTSW	18	65305983	missense	probably benign	0.00
R8280:Alpk2	UTSW	18	65307203	missense	probably benign
R8383:Alpk2	UTSW	18	65305398	missense	probably benign	0.03
R8414:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
R8791:Alpk2	UTSW	18	65305526	missense	probably benign	0.00
R8872:Alpk2	UTSW	18	65280906	missense	probably damaging	1.00
R9352:Alpk2	UTSW	18	65306712	missense	probably benign	0.01
R9449:Alpk2	UTSW	18	65291393	missense	probably damaging	1.00
R9525:Alpk2	UTSW	18	65266217	missense	probably damaging	1.00
R9564:Alpk2	UTSW	18	65305943	missense	probably damaging	1.00
R9710:Alpk2	UTSW	18	65349575	missense	probably damaging	1.00
X0023:Alpk2	UTSW	18	65291400	missense	probably damaging	1.00
X0027:Alpk2	UTSW	18	65307471	missense	possibly damaging	0.89
X0063:Alpk2	UTSW	18	65307363	missense	probably benign
X0064:Alpk2	UTSW	18	65349684	missense	probably benign	0.09
Z1176:Alpk2	UTSW	18	65305611	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTTCAAAGACGGGAGCTTCTAG -3'
(R):5'- AACCAGCCTGTGTGTCAGAG -3'

Sequencing Primer
(F):5'- GGAGCTTCTAGAGTTATGATCTTCAC -3'
(R):5'- AGAGGCCTTGAGGAGCACTTC -3'

Posted On

2016-10-05